ID: 1060186886

View in Genome Browser
Species Human (GRCh38)
Location 9:121568945-121568967
Sequence GCTTCCAGGAGATCAGCAAC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 180
Summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 165}

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1060186886_1060186894 -1 Left 1060186886 9:121568945-121568967 CCGGTTGCTGATCTCCTGGAAGC 0: 1
1: 0
2: 0
3: 14
4: 165
Right 1060186894 9:121568967-121568989 CTGGCCAGGCAGGGAGGTAAGGG No data
1060186886_1060186902 30 Left 1060186886 9:121568945-121568967 CCGGTTGCTGATCTCCTGGAAGC 0: 1
1: 0
2: 0
3: 14
4: 165
Right 1060186902 9:121568998-121569020 GGAAGAGGAAAGGGACAGAGGGG No data
1060186886_1060186897 15 Left 1060186886 9:121568945-121568967 CCGGTTGCTGATCTCCTGGAAGC 0: 1
1: 0
2: 0
3: 14
4: 165
Right 1060186897 9:121568983-121569005 GTAAGGGATTCAAGAGGAAGAGG No data
1060186886_1060186893 -2 Left 1060186886 9:121568945-121568967 CCGGTTGCTGATCTCCTGGAAGC 0: 1
1: 0
2: 0
3: 14
4: 165
Right 1060186893 9:121568966-121568988 GCTGGCCAGGCAGGGAGGTAAGG No data
1060186886_1060186899 21 Left 1060186886 9:121568945-121568967 CCGGTTGCTGATCTCCTGGAAGC 0: 1
1: 0
2: 0
3: 14
4: 165
Right 1060186899 9:121568989-121569011 GATTCAAGAGGAAGAGGAAAGGG No data
1060186886_1060186900 28 Left 1060186886 9:121568945-121568967 CCGGTTGCTGATCTCCTGGAAGC 0: 1
1: 0
2: 0
3: 14
4: 165
Right 1060186900 9:121568996-121569018 GAGGAAGAGGAAAGGGACAGAGG No data
1060186886_1060186901 29 Left 1060186886 9:121568945-121568967 CCGGTTGCTGATCTCCTGGAAGC 0: 1
1: 0
2: 0
3: 14
4: 165
Right 1060186901 9:121568997-121569019 AGGAAGAGGAAAGGGACAGAGGG No data
1060186886_1060186896 9 Left 1060186886 9:121568945-121568967 CCGGTTGCTGATCTCCTGGAAGC 0: 1
1: 0
2: 0
3: 14
4: 165
Right 1060186896 9:121568977-121568999 AGGGAGGTAAGGGATTCAAGAGG No data
1060186886_1060186898 20 Left 1060186886 9:121568945-121568967 CCGGTTGCTGATCTCCTGGAAGC 0: 1
1: 0
2: 0
3: 14
4: 165
Right 1060186898 9:121568988-121569010 GGATTCAAGAGGAAGAGGAAAGG No data
1060186886_1060186890 -10 Left 1060186886 9:121568945-121568967 CCGGTTGCTGATCTCCTGGAAGC 0: 1
1: 0
2: 0
3: 14
4: 165
Right 1060186890 9:121568958-121568980 TCCTGGAAGCTGGCCAGGCAGGG No data
1060186886_1060186892 -7 Left 1060186886 9:121568945-121568967 CCGGTTGCTGATCTCCTGGAAGC 0: 1
1: 0
2: 0
3: 14
4: 165
Right 1060186892 9:121568961-121568983 TGGAAGCTGGCCAGGCAGGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1060186886 Original CRISPR GCTTCCAGGAGATCAGCAAC CGG (reversed) Intronic
900536084 1:3178468-3178490 GCCTCCGGGAGAACAGCAGCTGG - Intronic
902513290 1:16977413-16977435 GCAGCCAGGAGGCCAGCAACAGG - Intronic
904396457 1:30225449-30225471 GATTCCAGGTGAACAGCAGCCGG - Intergenic
906781617 1:48577715-48577737 GCATCCAGCAGAGCTGCAACTGG + Intronic
908642603 1:66242038-66242060 GCTTCAAGGAGGTCACCATCTGG + Intronic
909280253 1:73742249-73742271 ACTCTCAGGAGATCAGCAAGGGG - Intergenic
909394765 1:75157103-75157125 TCTCCCAGGCAATCAGCAACTGG + Intronic
910728980 1:90370229-90370251 GCTTACATGCGTTCAGCAACAGG - Intergenic
911165699 1:94722517-94722539 CTTTCCAGGACTTCAGCAACTGG + Intergenic
912628452 1:111226307-111226329 GCTTTCAGCAGATCAGGAAGAGG - Intronic
913402099 1:118447999-118448021 GCTGCCATGAGAACAGCAAGGGG - Intergenic
914441943 1:147715447-147715469 GTTTCCAGGAGGTGAGGAACTGG + Intergenic
915471888 1:156130533-156130555 GCTCCCAGGAGGTCAGCCATGGG - Intronic
917299849 1:173561687-173561709 CCTTCAAGGACATCAGCAACTGG + Intronic
920129440 1:203720475-203720497 GCTTCCTGGAGGTCAGGAAATGG + Intronic
920374302 1:205499160-205499182 GCTTCCAGTAGCTCCCCAACAGG - Intergenic
924074579 1:240320064-240320086 GCATCCAGGTTAGCAGCAACTGG + Intronic
1067657234 10:48204150-48204172 ACTTCCTGTAGATCAGCTACTGG - Intronic
1069821973 10:71233901-71233923 GCCGCCAGGAGATTAGAAACAGG + Intronic
1070261272 10:74858147-74858169 ATTTCCAGGAGAGCAGGAACGGG + Intronic
1070458249 10:76639634-76639656 GCTTCCAGGAGATGTGCATGTGG + Intergenic
1073716562 10:106114756-106114778 GCATCCAGCAGAGCAGCTACCGG - Intergenic
1074025431 10:109628742-109628764 GCTTCCAGGAGAGCTGAAAAGGG + Intergenic
1076687136 10:132203256-132203278 GCTCTCAGGAGCTCAGCCACGGG + Intronic
1079698185 11:23510438-23510460 GCTCCTAGCAGAGCAGCAACTGG - Intergenic
1080907839 11:36564599-36564621 GCTTTCAGGAGATCTGCTGCGGG - Intronic
1081177882 11:39951283-39951305 ACTTTCAGGAGAACAGCAAGGGG - Intergenic
1081413629 11:42787976-42787998 GCTTTCAGGAGTTGAACAACAGG + Intergenic
1081730596 11:45369375-45369397 CCTTCCAGGAGCTCACCAGCTGG + Intergenic
1083834349 11:65255426-65255448 GAGTCCAGGAAATCAGCTACAGG + Intergenic
1085796040 11:79540865-79540887 TCTTCCAGGTGAGCAGCAGCTGG + Intergenic
1088825855 11:113493709-113493731 GCTGCCTGGGGCTCAGCAACTGG + Intergenic
1089058780 11:115608964-115608986 GCTTCCAGGAGGTAAGGAGCTGG - Intergenic
1091750250 12:3017771-3017793 GCTTCCAGGAGCTGACCACCTGG + Intronic
1091809673 12:3385790-3385812 GCTTCCAGGAACCCAGCCACTGG + Intronic
1091901112 12:4144868-4144890 TCTTCCAGGAGATAAGCACAGGG + Intergenic
1093340675 12:17969149-17969171 TTTTCCAGGAGTTCAGCAATGGG - Intergenic
1101846937 12:108370191-108370213 GCTTCCAGGAGGACAACAAATGG + Intergenic
1104399782 12:128465842-128465864 GCTGCAAGGCAATCAGCAACCGG - Intronic
1105256885 13:18749721-18749743 ACTATCAGGAGATCAGCATCAGG + Intergenic
1105259571 13:18769095-18769117 ACTATCAGGAGATCAGCATCAGG + Intergenic
1105262247 13:18788412-18788434 ACTATCAGGAGATCAGCATCAGG + Intergenic
1109305424 13:60635012-60635034 ACTTACAGGACATCATCAACTGG - Intergenic
1109488256 13:63057126-63057148 ACTATCAGGAGAACAGCAACGGG - Intergenic
1110701759 13:78556559-78556581 GCTTCCAGGAAATCAGTACAGGG + Intergenic
1116373538 14:44168161-44168183 GCTTCCAAGACATCAGTACCTGG + Intergenic
1119561493 14:75593559-75593581 GCTTCCATGAGATCAGCTGGTGG + Intronic
1119679531 14:76581817-76581839 GCCTCCAGGCGTTCAGCTACAGG + Intergenic
1119703429 14:76770002-76770024 GCTTCCAGGCGCTCAGGGACAGG - Exonic
1121877610 14:97467935-97467957 TCTTTCAGGAGAACAGCAAGGGG + Intergenic
1122807884 14:104269863-104269885 GCTTCCAGGCAATCTCCAACAGG - Intergenic
1129065222 15:72897431-72897453 GCTGCCAGGAGATTAGGAAGAGG - Intergenic
1131114389 15:89785071-89785093 GCTTCCCTGAGATCAGCCCCAGG + Exonic
1131643850 15:94320767-94320789 GCTTCCATTAAATCAGCAGCTGG - Intronic
1132481833 16:170189-170211 GATTCCAGGACTTCAGCACCGGG - Intergenic
1132482701 16:174445-174467 GATTCCAGGACTTCAGCACCGGG - Intergenic
1132745256 16:1433716-1433738 GATTCCAGGTGAGCAGCAAGGGG + Intergenic
1132987649 16:2776471-2776493 GCTTCTAGGACATCAGCAGGAGG + Intronic
1133768112 16:8851775-8851797 GTTTCCAGGAGAGCAGTGACAGG - Intergenic
1135155567 16:20050050-20050072 GCCTCCAGGAGGGCAGAAACTGG - Intronic
1135551324 16:23400446-23400468 GCTTCCAGGAGACCAAGAGCAGG + Intronic
1136534064 16:30888864-30888886 GCTTCCAGCAGTTCTGGAACAGG + Exonic
1137532053 16:49283977-49283999 GTTTTCAGGAGCTCAGCATCAGG + Intergenic
1138508287 16:57490516-57490538 TCTCCCCGAAGATCAGCAACAGG - Intergenic
1141198527 16:81879577-81879599 GCTGCAAGGAGTTCAGCAAGAGG + Intronic
1142223360 16:88865860-88865882 GCCTCCAGGAGTGCAGCAACAGG - Exonic
1142236606 16:88925381-88925403 GCCTCCAGGAGATCTGCAGGGGG + Intronic
1144612926 17:16740424-16740446 ACTTCCAGGAGTACAGCAACTGG + Intronic
1144899858 17:18575168-18575190 ACTTCCAGGAGTGCAGCAACTGG - Intergenic
1144907249 17:18645541-18645563 GCTACCAGGAAATTAGCAAAGGG - Intronic
1145132586 17:20370501-20370523 ACTTCCAGGAGTGCAGCAACTGG + Intergenic
1147913269 17:43870692-43870714 GCTTCCAGGTACTCAGAAACAGG - Intergenic
1148238227 17:45983377-45983399 GCTTCTAGGAGACCTGCACCAGG + Exonic
1149078966 17:52631580-52631602 GCTATCATGAGATCAGCAAGGGG - Intergenic
1154426454 18:14275706-14275728 ACTATCAGGAGATCAGCATCAGG - Intergenic
1154429194 18:14295301-14295323 ACTATCAGGAGATCAGCATCAGG - Intergenic
1154431465 18:14311646-14311668 ACTCTCAGGAGATCAGCATCAGG - Intergenic
1154434147 18:14330950-14330972 ACTCTCAGGAGATCAGCATCAGG - Intergenic
1155225815 18:23728265-23728287 CCTTCCTGGACAGCAGCAACAGG + Intronic
1156388331 18:36626635-36626657 GCTTCCAGACTATCAGCAGCAGG - Intronic
1160313715 18:77821158-77821180 GGTTCCTGGAGCTCAGCAACAGG - Intergenic
1162097686 19:8320856-8320878 GCTACCAGGAGATCTCCAAGCGG - Exonic
1167196100 19:48029849-48029871 GCTTCCAGGAAATCAGGAAAAGG + Intergenic
1168168525 19:54571644-54571666 TCTTCCTGGACATCAGCAGCTGG - Intergenic
1168681203 19:58317208-58317230 GCTTCAAGGACAGCAGCCACAGG - Intergenic
925746496 2:7048264-7048286 CCTTCCAGGGGATAAGCATCAGG + Intronic
927201775 2:20582668-20582690 GCATCTAGGAGATCAGCTAAGGG + Intronic
927525108 2:23732709-23732731 TATTCCAGCAGATCAGAAACTGG - Intergenic
927897900 2:26796652-26796674 GCTTCCAGCAGAGCAGCAGTGGG - Intronic
928085974 2:28346670-28346692 GCCTGCAGCAGATCAGCAATGGG - Intergenic
928541742 2:32291888-32291910 GCTTCCAGGAGACTGGCAAAAGG + Intronic
929657341 2:43747214-43747236 GATTCCAAAAGATCAGGAACTGG - Intronic
935270426 2:101429800-101429822 GCTTCCAGAAGCACAGCAAGAGG - Intronic
935669383 2:105542254-105542276 GCTTCCGAGAAATCAGCAAAAGG - Intergenic
937222552 2:120350146-120350168 GCCTCCAGGATACCAGCAAATGG + Exonic
938014800 2:127858245-127858267 GCCTCCAGGACCTCACCAACCGG - Intergenic
938050683 2:128167867-128167889 TGTTCTAGGTGATCAGCAACAGG - Intronic
939134710 2:138279505-138279527 GCTTCCAGGTGATCTGAGACAGG + Intergenic
939136223 2:138297804-138297826 GCTCTCAGGAGATTAGCAACAGG - Intergenic
940419592 2:153464107-153464129 GCTTCCAGGTGACCAGCTAATGG - Intergenic
941131106 2:161651295-161651317 GCTTTCAGGAGACCAGCAGTGGG - Intronic
946079157 2:217102127-217102149 ACTTTCAGGAGAACAGCAAGGGG - Intergenic
946942841 2:224787709-224787731 GATTACAGGAGAGCAGCAATTGG - Intronic
948531156 2:238606518-238606540 GTTTCCAGGCGATGAGCAGCAGG - Intergenic
1176845578 21:13874122-13874144 ACTATCAGGAGATCAGCATCAGG + Intergenic
1176848313 21:13893672-13893694 ACTATCAGGAGATCAGCATCAGG + Intergenic
1185089312 22:48756973-48756995 TCTCCCAGGAGAGCAGCAATGGG + Intronic
949748992 3:7329224-7329246 GCTTCCAGGAGGAGAGAAACAGG + Intronic
951272948 3:20649892-20649914 ACTACCATGAGATCAGCAAGAGG - Intergenic
955271732 3:57506309-57506331 GCTTCTAAGAGTTTAGCAACTGG - Intronic
958130179 3:89409038-89409060 GCTTCCTGCAGGTTAGCAACAGG - Intronic
959777781 3:110188834-110188856 ACTACCAGGAGAACAGCAAGGGG + Intergenic
961056404 3:123792671-123792693 GCTAACAGGAGAGAAGCAACAGG - Intronic
962909314 3:139833394-139833416 GCTTTCAGGAAATCAGCAAGTGG - Intergenic
962917347 3:139916723-139916745 GATTCCAGGATATCAGCTTCTGG + Intergenic
965208965 3:165759878-165759900 GCTTTGAGCAGATGAGCAACAGG - Intergenic
969872719 4:10115006-10115028 CCCTCCAGGAGGCCAGCAACTGG - Intronic
970487589 4:16540127-16540149 ACTGCCAGGAGAACAGCAAGGGG + Intronic
971108250 4:23551413-23551435 AGTTCCAGGAGATAAGCAAGTGG + Intergenic
971621975 4:28866747-28866769 GCATACAGGAGATCAGCCAAAGG - Intergenic
973280032 4:48350290-48350312 GCTACCAGGGTATCAGCACCAGG - Intronic
974095825 4:57362696-57362718 GCTTCCTAGAGCCCAGCAACCGG + Intergenic
976203349 4:82600848-82600870 GCTTCCTGTAGCTCAGCAATGGG + Intergenic
979359467 4:119744815-119744837 GCTTCCTGGAGATGATCAAATGG + Intergenic
981446559 4:144846006-144846028 GCTTCGAGAAGATTAGCAAAGGG + Intergenic
984188530 4:176576524-176576546 GCTACCAGGAGATCAGAAAGTGG - Intergenic
984443399 4:179802271-179802293 GCTTCTGGGAGATCAGCATGTGG + Intergenic
984596144 4:181669883-181669905 CATTCCAGCACATCAGCAACAGG + Intergenic
986224509 5:5800626-5800648 TCTTCCAGGATGTCAGGAACGGG + Intergenic
991925168 5:71698270-71698292 GCTTCCTGGAAAGCAGCAAGCGG + Intergenic
991977770 5:72199748-72199770 GCCTCCAGGAGGAAAGCAACAGG + Exonic
993384608 5:87249778-87249800 GCTCCCAAGAAATCAGCACCAGG - Intergenic
995606188 5:113858132-113858154 GAGTCCAGGAGATCAAGAACAGG - Intergenic
996169405 5:120270063-120270085 GCTTCCAGGATTTCAGCATTTGG + Intergenic
998003587 5:138642887-138642909 GCCTCTGGGAGATCAGCAAGTGG + Intronic
998059888 5:139111617-139111639 ACTTCCAGGAGTTCAACAAATGG + Intronic
1000780751 5:165477737-165477759 GCTTCCAGGATCTCTGCAACAGG + Intergenic
1001755701 5:174166952-174166974 GCTTCCAGGACAGCAGTCACAGG - Intronic
1002402950 5:179002308-179002330 GCTATCATGAGAACAGCAACGGG + Intergenic
1003925220 6:10871225-10871247 GCTTCCAGGATCTCAGCATTTGG + Intronic
1007828534 6:44620226-44620248 GCTTCCAGAAGCTCACCACCAGG + Intergenic
1009229342 6:61043552-61043574 GCCCCCAGGAGACCAGCAAAAGG - Intergenic
1018047947 6:159981131-159981153 GCTTCCAGCAGAAGAGCAGCAGG - Intronic
1023966181 7:44964133-44964155 GCTTCCACAAGATCCGGAACCGG - Exonic
1024532411 7:50404863-50404885 GTTTCCAGGAGATCAGAAAAGGG - Intronic
1025966815 7:66280717-66280739 GCTTCCAGCAGCACATCAACTGG + Intronic
1027344403 7:77242348-77242370 TCTTCTAAGAGAGCAGCAACAGG + Intronic
1027600764 7:80237826-80237848 GCTATCAGGAGAACAGCAAGGGG + Intergenic
1029218220 7:98967816-98967838 TCTTCCTGGAGATCAGAAGCAGG - Intronic
1029880485 7:103803767-103803789 ATTTCCAGGATAACAGCAACTGG + Intronic
1030277932 7:107739920-107739942 CCTTCCAGTATATAAGCAACAGG - Intergenic
1031894507 7:127333225-127333247 GCTTTCAGGAGATTAGCATTAGG + Intergenic
1032602034 7:133307942-133307964 GCTTCCATGAAAACAGTAACCGG + Intronic
1035383776 7:158457207-158457229 GCTTTCAGGAAATAAGCATCAGG - Intronic
1038276507 8:26125913-26125935 GCTTCCATGAGCTTAGCCACAGG + Intergenic
1040465588 8:47691968-47691990 GCTTCCAGGAAATGAAAAACTGG - Intronic
1042589066 8:70378067-70378089 TCTTCCAGGAAATAAGTAACTGG - Intronic
1042791255 8:72608567-72608589 GCTTCCAGGAGCACACCCACAGG - Intronic
1044859359 8:96507623-96507645 GCTTCCTGGAGATAAGAATCGGG + Intronic
1046108522 8:109693442-109693464 GCTTCCAGGACCTCTGCATCAGG + Intergenic
1046630172 8:116616158-116616180 CCTACCATGAAATCAGCAACTGG - Intergenic
1048724088 8:137361789-137361811 GGTTCCAGGACATTAGCAAAGGG - Intergenic
1048852936 8:138661898-138661920 GCTTCCTGGAAATCCTCAACCGG + Intronic
1050113842 9:2242699-2242721 GCCTCCCCGAGATCAGCAGCTGG - Intergenic
1051864138 9:21659990-21660012 AAATCCATGAGATCAGCAACAGG - Intergenic
1052846194 9:33338628-33338650 GCTTCCAGAAGCCCAGCACCTGG - Intronic
1053271107 9:36750077-36750099 GCTTCCTGGAGTTCTGCAAAAGG - Intergenic
1056545325 9:87608078-87608100 TCTATCAGGAGATCAGCAAGGGG + Intronic
1056622371 9:88225081-88225103 GCTTGCAGGAGCTCAGCAGGTGG + Intergenic
1057948506 9:99351060-99351082 GCTTCCAGGAGATAATGAACTGG - Intergenic
1059475845 9:114547038-114547060 GACTCCAGGATATGAGCAACAGG - Intergenic
1060186886 9:121568945-121568967 GCTTCCAGGAGATCAGCAACCGG - Intronic
1060315160 9:122502998-122503020 CCCTCCAGGAGATCATCTACAGG + Intergenic
1060341895 9:122784848-122784870 GCTTCCAGGGGTACAGAAACAGG - Intergenic
1061059426 9:128243207-128243229 TCTTAAAGGAGACCAGCAACAGG - Intronic
1061232662 9:129323872-129323894 TCCCCCAGGAGATAAGCAACAGG - Intergenic
1186636069 X:11406289-11406311 GTTGCCAGGGGATCAGCAATGGG - Intronic
1190681806 X:52832164-52832186 GCTTGCCGGAGCTTAGCAACAGG + Intergenic
1199773329 X:150989243-150989265 GCATCCAGGAGACCAGCAGCAGG - Exonic
1201575692 Y:15459484-15459506 GCTTGGAGGAAACCAGCAACGGG - Intergenic