ID: 1060187670

View in Genome Browser
Species Human (GRCh38)
Location 9:121573888-121573910
Sequence CACAGGGAGGGGCCTCCAGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 506
Summary {0: 1, 1: 0, 2: 7, 3: 77, 4: 421}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1060187670_1060187680 2 Left 1060187670 9:121573888-121573910 CCACCTGGAGGCCCCTCCCTGTG 0: 1
1: 0
2: 7
3: 77
4: 421
Right 1060187680 9:121573913-121573935 TGTGGAAAATCCTCTCTCCCGGG No data
1060187670_1060187679 1 Left 1060187670 9:121573888-121573910 CCACCTGGAGGCCCCTCCCTGTG 0: 1
1: 0
2: 7
3: 77
4: 421
Right 1060187679 9:121573912-121573934 CTGTGGAAAATCCTCTCTCCCGG No data
1060187670_1060187681 3 Left 1060187670 9:121573888-121573910 CCACCTGGAGGCCCCTCCCTGTG 0: 1
1: 0
2: 7
3: 77
4: 421
Right 1060187681 9:121573914-121573936 GTGGAAAATCCTCTCTCCCGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1060187670 Original CRISPR CACAGGGAGGGGCCTCCAGG TGG (reversed) Intronic
900206934 1:1435631-1435653 CTCGGGGAGGGGCCTCCCGGGGG + Intronic
900287635 1:1909164-1909186 CGCGGGGCGGGGCTTCCAGGTGG + Intergenic
900314591 1:2050555-2050577 CGCGGGGCGGGGGCTCCAGGTGG - Exonic
900459637 1:2796667-2796689 CACAGCAAGGGGGCTCCAGGAGG - Intronic
900556930 1:3285250-3285272 GAGAGGCAGGGGCCTCCACGGGG - Intronic
900573582 1:3372042-3372064 CACAGGGAGTGACTTCCAGATGG - Intronic
900586646 1:3435810-3435832 CACGGGGAGGCTCCTGCAGGAGG + Exonic
900689605 1:3972580-3972602 CACAGGGAGAGGCCTCAGGGAGG + Intergenic
901090439 1:6637369-6637391 CACAAGGAGGTGCCTGGAGGAGG - Intronic
901303595 1:8217108-8217130 CAGAAGGAGGAGCCCCCAGGTGG + Intergenic
901317311 1:8317959-8317981 CACCGGGACGGGCCTCCCGCGGG + Intronic
901941170 1:12663063-12663085 CACAGATAAGGGCTTCCAGGAGG + Intronic
902191535 1:14766562-14766584 CACAGAGAGGGGCCTTGGGGAGG + Intronic
903264994 1:22152834-22152856 CGCAGCTTGGGGCCTCCAGGAGG + Intergenic
903669678 1:25028091-25028113 CCCATGGATGTGCCTCCAGGGGG + Intergenic
904006114 1:27364169-27364191 CCCAGGGAGGGTGCTCCAGGAGG - Intronic
904302251 1:29561841-29561863 CTCAGGGAGGTGAATCCAGGTGG + Intergenic
904615740 1:31748581-31748603 GACAAGGAGGGGCCCCCAGAAGG + Intronic
907413359 1:54297763-54297785 TACAGGGAAGGGCCTTCTGGGGG - Intronic
911133929 1:94418858-94418880 CTCAGGCAGCGGCCTCCAGTTGG + Intronic
912099931 1:106192273-106192295 CACTGGGAGGGGCCTCCCAACGG + Intergenic
915580806 1:156812173-156812195 CAGAGGTGGGTGCCTCCAGGAGG - Intronic
915580891 1:156812672-156812694 CAGAGGCAGGTGCCTCCAGGAGG + Intronic
915891114 1:159774743-159774765 CAGAGGGAGAGGCCTCAAAGGGG - Intergenic
915900291 1:159841902-159841924 CAGAGGGAAGGGCCTCCCTGAGG + Intronic
916058665 1:161084728-161084750 CCCAGGGAGAGGCCTCCTTGGGG - Intronic
916721651 1:167488903-167488925 CCCAGGGAGGGCCTGCCAGGAGG + Intronic
916744782 1:167676746-167676768 GCCTGGGAGGGTCCTCCAGGTGG - Intronic
917542803 1:175931455-175931477 CACAGGGAGGGGCCTGTTGGGGG - Intergenic
917582355 1:176391795-176391817 CACTGGGTGGGGCCTCCCTGCGG - Intergenic
918413677 1:184286242-184286264 CAAGGGGAAGGGGCTCCAGGTGG - Intergenic
919633625 1:199982878-199982900 CACAGGGAGGGGCATCACTGTGG - Intergenic
920230227 1:204465355-204465377 CATAGGGAGGGGACACCACGAGG - Intronic
921051308 1:211513903-211513925 CACTGGGGTGGGACTCCAGGTGG + Intergenic
922561433 1:226572568-226572590 CAGAGGGCAGGGCCTCCCGGTGG + Intronic
922876294 1:228942391-228942413 CAAAGGGAGGGGACTCAAAGAGG - Intergenic
922968174 1:229710101-229710123 CACAGGTAGGGCCCTCTATGTGG - Intergenic
923804095 1:237239338-237239360 CAGAGAGAGGGGCTTCCAAGTGG + Intronic
924473437 1:244363554-244363576 CTCTGGGTGGGGCCCCCAGGAGG + Intronic
924584088 1:245346412-245346434 CAAAGCCAGGGGTCTCCAGGAGG - Intronic
924629574 1:245724181-245724203 CACTGGGTGGGGCCTCCCTGTGG + Intergenic
924952553 1:248898013-248898035 CACTGGGTGGGGCCTCCCTGTGG + Intergenic
1062923276 10:1296070-1296092 GACAGGAAGGGGTCTCCAGAGGG - Intronic
1064254076 10:13729291-13729313 CACAGGGTGTGGCTTCCAAGGGG + Intronic
1064317476 10:14271536-14271558 CACAGAGAGTGGCCTCCACCAGG + Intronic
1065492567 10:26296608-26296630 CACAGGGAGGGGCAGCAAGTGGG + Intronic
1065783571 10:29192739-29192761 CACAGTGAGGGGACTCAGGGAGG - Intergenic
1067099206 10:43322524-43322546 CAAAGGGAGCGGCCTTCAGGAGG + Intergenic
1067183278 10:44006266-44006288 CCCAGGGAAGTGCCCCCAGGGGG - Intergenic
1069360203 10:67633160-67633182 CACAGGGTGGGACCTCCCTGTGG + Intronic
1069797687 10:71063681-71063703 CACAGGGGCCGGCCTCCAGGAGG + Intergenic
1069997718 10:72353315-72353337 CACAGGGAGGCTCCTCGAGCAGG + Intronic
1070675264 10:78407627-78407649 CACAGGGAGGGACCCCCAGGAGG - Intergenic
1070789549 10:79181191-79181213 CACTGGGAAGGGCCATCAGGAGG - Intronic
1070987507 10:80701123-80701145 CATAGGTAGGTGCCTCCTGGAGG + Intergenic
1071095693 10:81971701-81971723 CACAGGGAGGAGAACCCAGGTGG + Intronic
1072921373 10:99579831-99579853 CCCAGGGTGGGGCCTCCCGGTGG - Intergenic
1073036158 10:100565448-100565470 GACAGTGAGGGGCCTCCCTGGGG + Intergenic
1074104205 10:110376490-110376512 CACAGGAAGTGGCCTTGAGGTGG - Intergenic
1074107816 10:110401685-110401707 TGCAGGGAGGGGTCCCCAGGTGG + Intergenic
1074826214 10:117217170-117217192 CCGAGGCAGGGGGCTCCAGGTGG - Intergenic
1074921662 10:118020523-118020545 CACCGGGAGGCACCTCCAAGAGG + Intronic
1075007247 10:118839900-118839922 CACAAGGTTGGGCTTCCAGGAGG - Intergenic
1075380209 10:122012766-122012788 TCCATGGAGGGGGCTCCAGGTGG + Intronic
1075416352 10:122267457-122267479 GACAGACAGGGGCTTCCAGGAGG - Intergenic
1075857019 10:125638204-125638226 CACGGGGAGGGGCCTGCACCTGG - Intronic
1076055848 10:127372250-127372272 CCCAAGGAGGGGCCTCCAAATGG - Intronic
1076463137 10:130660069-130660091 CTCAGGGAGGGGCATTCAGAAGG + Intergenic
1076704545 10:132293970-132293992 CACAGGCAGGGGCCTTCAGGCGG + Intronic
1077024881 11:434685-434707 CACAGGGAGGATCCTGCAGCAGG + Intronic
1077096613 11:801735-801757 CACAGGGAGCAGGATCCAGGAGG + Intronic
1077124443 11:926157-926179 CCCGGGGCGGGGCCTCGAGGCGG + Intronic
1077140833 11:1024165-1024187 CACACTGAGGGCCCTGCAGGTGG - Intronic
1077384539 11:2262837-2262859 GGCAGGGAGGGGCCTCCTGGGGG - Intergenic
1077530643 11:3093255-3093277 CACAGGGAGGTCCCTGCAGGCGG - Intronic
1077890180 11:6412906-6412928 CAGAGGGAGGGGTCTGGAGGGGG - Intronic
1081849468 11:46265173-46265195 CACAGGGAGAGGCAGCCAGCAGG + Intergenic
1081872663 11:46390666-46390688 GACATGGAGGAGCCTCCAGATGG - Intergenic
1082746513 11:56968720-56968742 CACTGGGCGGGGCCTCCCTGTGG - Intergenic
1082757484 11:57092284-57092306 CACTGGGTGGGGCCTCCCTGCGG - Intergenic
1083129171 11:60607549-60607571 AACAGGGAGGGGCCCTCAGAAGG - Intergenic
1083184041 11:61007375-61007397 CACAGGGTCAGGCCTCAAGGTGG + Intronic
1083321315 11:61848799-61848821 CACTGGGAGGAGCCTCAACGTGG + Intronic
1083745405 11:64733441-64733463 CACAGCCTGGGGCCTGCAGGAGG + Intronic
1083800909 11:65045782-65045804 TCCTGGGAGGTGCCTCCAGGTGG - Intronic
1083842914 11:65314993-65315015 CACAGAGATGGGCCTCTCGGGGG - Intronic
1083879405 11:65540700-65540722 CCCCGGGCGGGGCCTACAGGAGG + Intronic
1083943871 11:65913193-65913215 CCCAGGGAGGAGGCTCCAGAGGG - Intergenic
1084161584 11:67353248-67353270 GACACGGAGGGGCCTAGAGGAGG - Intronic
1084166173 11:67375691-67375713 CACAAGGAGCGGCTTCGAGGCGG - Intronic
1084321763 11:68377232-68377254 CTCAGGAAGGGACCTGCAGGCGG - Intronic
1084639105 11:70413975-70413997 CACAGGTCGGGGCCACCAGTGGG - Intronic
1084878713 11:72154187-72154209 CAAAGGGAGGGGACTCAAAGAGG - Intergenic
1086279761 11:85171887-85171909 CACTGGGTGGGGCCTCCCTGTGG + Intronic
1089393627 11:118118837-118118859 CACACTGAGGGCTCTCCAGGCGG - Exonic
1089665381 11:120014597-120014619 CACAGGCAAAGGGCTCCAGGAGG - Intergenic
1089735318 11:120546764-120546786 CAGTGGGAGGGGACTTCAGGAGG - Intronic
1089783061 11:120887865-120887887 GACTGGGAGGGGCCTCCCTGAGG + Intronic
1090444945 11:126756418-126756440 CAGAGAAAGGGGCTTCCAGGAGG + Intronic
1090623177 11:128579912-128579934 CCCATGGAGGGGCATCAAGGAGG - Intronic
1091088679 11:132748628-132748650 GCGAGGGAGGGGCCTGCAGGGGG + Intronic
1091601888 12:1922656-1922678 CACTCGGAGGGGCCAGCAGGAGG + Intergenic
1091801259 12:3326192-3326214 GACACGGATGGGCCTGCAGGGGG - Intergenic
1092919940 12:13222311-13222333 AGCAGGGTGTGGCCTCCAGGTGG + Intergenic
1093786340 12:23195825-23195847 CACAGGGAGGGGCCTGTTGGGGG - Intergenic
1093934967 12:24990684-24990706 CCCAGGAAGGGCTCTCCAGGAGG - Intergenic
1094248372 12:28329758-28329780 CACAGGGTGGGGCCTGGGGGAGG - Intronic
1094819914 12:34216329-34216351 GAGACGGAGGGGCCTCCAGAAGG + Intergenic
1094825206 12:34264370-34264392 AAGAGGGAGGGACCTCCAGAAGG - Intergenic
1095085353 12:38053718-38053740 GAGAGGGAGGGGCCTCCAGGAGG + Intergenic
1095094830 12:38141179-38141201 GAGAGGGAGGGGCCTCCAGAGGG - Intergenic
1095128958 12:38514579-38514601 CACAGGGAGGGGCCTGTCAGGGG + Intergenic
1095562516 12:43583021-43583043 CACAGGGAGGGGCCTGTTGGGGG + Intergenic
1097033101 12:56104052-56104074 AACAGGGAGGGGCAGACAGGTGG - Intronic
1097368650 12:58748169-58748191 CACAGGGAGGGGCCTGTCAGGGG - Intronic
1097643103 12:62205541-62205563 CACTGGGTGGGGCCTCCCTGGGG - Intronic
1100179119 12:92064796-92064818 CACAGGGAGGGGCCCCAAATAGG + Intronic
1101852811 12:108417789-108417811 CACATGGAGGGGTTTCCAGCTGG - Intergenic
1103624134 12:122205746-122205768 CAGAGGTCGGGGCTTCCAGGAGG - Intronic
1103744933 12:123116076-123116098 AAAAGGGAGGGGACTCCACGAGG - Intronic
1104040787 12:125129140-125129162 CACAGGGAGGGGACTTCATCTGG + Intronic
1104801581 12:131558410-131558432 CACAGTGATGGGCCGTCAGGCGG + Intergenic
1104806149 12:131590744-131590766 CACAGGGAGGACCCTGGAGGAGG + Intergenic
1105821573 13:24085485-24085507 CACAGGGCAGGGCTTCCAGACGG - Intronic
1106141429 13:27015164-27015186 CACAGAGAGGGGACTTGAGGAGG + Intergenic
1107417153 13:40211391-40211413 CAGGGAAAGGGGCCTCCAGGAGG + Intergenic
1107976448 13:45693119-45693141 CAAAGAGAAGGGCCTCCTGGAGG + Intergenic
1108408017 13:50124325-50124347 CCCAGGGCGGGGACTCCGGGCGG + Intronic
1108525237 13:51280714-51280736 GCCAGGGAGGGGCCTCCCGTGGG - Exonic
1109520647 13:63505699-63505721 CTAAGGGAGGGGACTCCAAGAGG + Intergenic
1111319229 13:86603638-86603660 CATAGGGAGGGGTCACCAGGAGG - Intergenic
1112187312 13:97139812-97139834 CACAGCCAGAGGCCTCCATGAGG + Intergenic
1113158095 13:107348603-107348625 CACACGCAGGGGCCTGCCGGGGG - Intronic
1113814880 13:113162999-113163021 CACGGGGAGCCGCCTGCAGGAGG - Exonic
1113992880 14:16042304-16042326 GAGAGGGAGGGGTCTCCAGAAGG - Intergenic
1114600430 14:23951903-23951925 CAAAGGGACAGGCCTGCAGGGGG - Intergenic
1114604613 14:23986738-23986760 CAAAGGGACAAGCCTCCAGGGGG - Intronic
1116446627 14:45019527-45019549 CAAAGGGAGGGGACCCAAGGAGG + Intronic
1118473241 14:66094218-66094240 GGCAGAGAGGGGCCTCGAGGCGG - Intergenic
1119425722 14:74533646-74533668 CACAAGGAAGGGCGTTCAGGAGG - Intronic
1119851065 14:77867074-77867096 CACAGCCAGGGCGCTCCAGGGGG - Intronic
1119919688 14:78434952-78434974 GACAGAGAGGGGCTTGCAGGCGG + Intronic
1121030454 14:90654189-90654211 CACACGGAGGGCTCCCCAGGGGG + Intronic
1121414736 14:93771561-93771583 CCCAAGCAGGGACCTCCAGGTGG + Intronic
1121568304 14:94927024-94927046 CATCAGGAGGGGCTTCCAGGAGG - Intergenic
1121816358 14:96932013-96932035 CACAGGGAGGAGCATACAAGTGG + Intergenic
1122602170 14:102927409-102927431 AACAGGGAGGGGTTCCCAGGAGG - Intronic
1122621375 14:103059287-103059309 CACAAGGAGAGGCCTCTAGGGGG + Intergenic
1122669145 14:103356629-103356651 CAAAGGGTGGGGCCTTCATGAGG + Intergenic
1123161904 14:106286881-106286903 CACCAGGAAGCGCCTCCAGGTGG + Intergenic
1123637784 15:22376033-22376055 CCAGGGGAGGGGCCTCCTGGTGG + Intergenic
1124055555 15:26238111-26238133 CACTGGGAGGGGTCACCATGGGG + Intergenic
1124196945 15:27639584-27639606 CACTGGGCGGGGCCTCCATGCGG + Intergenic
1124382403 15:29177722-29177744 CAGAGGAAGGGACATCCAGGCGG + Intronic
1124434489 15:29635640-29635662 CACAGGGAGAGGCCTACACGGGG - Intergenic
1124577522 15:30923003-30923025 GACAGGGAGGGGCCTGCTGGCGG - Intronic
1124880521 15:33638311-33638333 CAGAGGGAGGGGACTGCATGAGG - Intronic
1125328904 15:38564176-38564198 GGCCGGGAGGGGCCACCAGGTGG + Intronic
1125519438 15:40339852-40339874 CACAGGGAGCGGCAGCCAAGTGG + Intronic
1125874738 15:43133921-43133943 CGCAGGGTGCGGCCTCCTGGGGG - Exonic
1128075409 15:64822584-64822606 CACAGGCAGGGGCCACCTTGGGG + Exonic
1128145865 15:65332232-65332254 CACCTGGAGGAGTCTCCAGGGGG - Intronic
1128549961 15:68591657-68591679 CACAGGGAGAGACCTTCAGGAGG - Intronic
1128601732 15:69000772-69000794 TAGCAGGAGGGGCCTCCAGGAGG + Intronic
1128761577 15:70219729-70219751 CACAGGGTGGAGCCTGGAGGAGG - Intergenic
1129295685 15:74598812-74598834 CTCAGGGAGGAGCTTCCAGGAGG + Intronic
1129774116 15:78223260-78223282 CATAGGGAGGGGCCTGTTGGGGG + Intronic
1129832953 15:78682455-78682477 CCCAGGGAGGTGCCTGCAGGAGG + Intronic
1130172105 15:81525473-81525495 CACAGGGCGGCGCCTCAAGGAGG - Intergenic
1131048322 15:89330179-89330201 CACCAGTAGGGACCTCCAGGGGG + Exonic
1132043590 15:98546216-98546238 CACAGGTGGGAGTCTCCAGGAGG + Intergenic
1132285396 15:100658717-100658739 CTCAGGAGGGGGCCTCCAGGCGG + Intergenic
1132332493 15:101022507-101022529 GACGGGGAGGGCCCCCCAGGTGG + Exonic
1132338023 15:101061189-101061211 CACAGAGAAGGGCCTCATGGAGG + Exonic
1132457847 16:33919-33941 CTCAGGGAGGGCCTTCCAGGAGG + Intergenic
1132462771 16:63545-63567 CGGAAGGAGGGGCCTGCAGGAGG + Intronic
1132500697 16:283419-283441 CAAAGGGTGGGGCCCCCAGGTGG - Intronic
1132641339 16:979934-979956 CGGAGGGCAGGGCCTCCAGGGGG + Intronic
1133026627 16:2991460-2991482 CGCAGGGAGGGGCGGGCAGGAGG + Intergenic
1135091963 16:19524296-19524318 CAAACCGAGGGCCCTCCAGGCGG - Intronic
1136275169 16:29175567-29175589 CTGAGCAAGGGGCCTCCAGGTGG + Intergenic
1136515728 16:30767035-30767057 CACAGTGAGGGTCCGCCAGCTGG + Intronic
1136912248 16:34154056-34154078 GAGAGGGAGGGGCCTCCAGAAGG - Intergenic
1137882193 16:52061559-52061581 CACAGGGAGGGGATGGCAGGGGG + Intronic
1138232181 16:55346404-55346426 CACAGTGTGGAGCTTCCAGGAGG - Intergenic
1138263416 16:55642018-55642040 GACAGGGAGGGGCAACCAGGGGG + Intergenic
1138565212 16:57828098-57828120 CTCAGGGAAGAGCCTCCAAGAGG - Intronic
1139420550 16:66847020-66847042 CAATGCGAGGGGCCTGCAGGTGG - Exonic
1139878288 16:70163889-70163911 CACAGGGGAGGGCTGCCAGGAGG - Intergenic
1141140813 16:81495742-81495764 AGCAGGCAGGGGCTTCCAGGAGG - Intronic
1141523074 16:84594312-84594334 CACAGGGCGGGGCTGCCAGGTGG + Intronic
1141682668 16:85553526-85553548 CGCTGGGAGGGGGCGCCAGGCGG + Intergenic
1141685497 16:85567516-85567538 CACACTGAGGGGCCACGAGGAGG - Intergenic
1141742434 16:85902756-85902778 CAGTGGGAGGGGCCTGCAGGGGG + Intronic
1141795518 16:86270783-86270805 GACAGGGATGAGCCTCCTGGGGG + Intergenic
1142079528 16:88141635-88141657 CTGAGCGAGAGGCCTCCAGGTGG + Intergenic
1142409849 16:89910469-89910491 GACACGGAGGGGCCGCCAGGGGG - Intronic
1143319986 17:6061928-6061950 CACATGGAGGGGCTTCAAGGAGG + Intronic
1143476118 17:7204829-7204851 CCGAGGGAGGGGCCTGCAGCTGG - Intronic
1143481147 17:7227944-7227966 CTCAGGGAGGGGCCTGAAGTTGG - Intronic
1143610697 17:8016041-8016063 GACAGGGCGGGGCCTCCGGGAGG - Intronic
1143630879 17:8139763-8139785 CACAGAGAGGGCCCTTCAGCAGG - Intergenic
1144764460 17:17725054-17725076 CAGGGGGAGGGGGCTCCTGGGGG + Intronic
1144951178 17:18994327-18994349 CACAGGGAGGGGCGCCCCCGTGG + Intronic
1144960141 17:19040151-19040173 GTCAGGGAGGGGCCTTCAGGTGG - Intronic
1144975019 17:19134373-19134395 GTCAGGGAGGGGCCTTCAGGTGG + Intronic
1145317698 17:21744693-21744715 CTCAGTGAGGGGACACCAGGTGG + Intergenic
1145786169 17:27595259-27595281 AACAGAGAGAGGGCTCCAGGGGG - Intronic
1148550929 17:48550518-48550540 TAGAGGGAGGGGCCGGCAGGGGG + Exonic
1148752801 17:49955284-49955306 GGCTGGGAGGGGCCTCCAGCAGG - Intergenic
1148759094 17:49990209-49990231 CACAGGGAGATCCGTCCAGGAGG + Exonic
1150830299 17:68512637-68512659 CACGGGGAGCGACCTGCAGGGGG + Intronic
1150832468 17:68536530-68536552 CACAGGGAGGGGCATCTAGAGGG + Intronic
1151718586 17:75843679-75843701 CCCAGGGACGGACCTCCAGGAGG - Intronic
1151825008 17:76519255-76519277 CAGGGGGAGGGGACGCCAGGTGG - Intergenic
1152724728 17:81939572-81939594 CGCTAGGAGGGGCCGCCAGGAGG + Intronic
1152917997 17:83051886-83051908 CATAGGGGTGGGCCTCCCGGAGG + Intergenic
1152961849 18:84642-84664 CTCAGGGAGGGGCTTCCAGGAGG + Intergenic
1153671891 18:7419528-7419550 CACAGGGCAGGGCCAGCAGGAGG + Intergenic
1153814108 18:8778565-8778587 CACAGGGACAGGGCTGCAGGAGG - Intronic
1153858430 18:9174015-9174037 CACTGGGTGGGGCCTCCCTGAGG - Intronic
1154200529 18:12296643-12296665 CACAGGGTGGGCCCTCCAGCTGG + Intergenic
1157493392 18:48139087-48139109 CACAGGGACAGGGCTACAGGAGG + Intronic
1157809008 18:50679866-50679888 CACGGGGAGAGGCCACCAGGAGG - Intronic
1157920756 18:51710685-51710707 AAAAGGGAGAGGACTCCAGGAGG + Intergenic
1159897159 18:74008272-74008294 CAGAGGTAGGAGGCTCCAGGTGG + Intergenic
1160037622 18:75316375-75316397 CACAGCGTGGGGCATGCAGGAGG - Intergenic
1160453330 18:78979729-78979751 CTCCGGGAGGGGCCGCCCGGCGG + Intergenic
1160749815 19:728415-728437 GGCAGGGAGGGGCCCCCACGGGG - Intronic
1160841158 19:1147569-1147591 CATACAGAGGGGCCTCCAGGGGG + Intronic
1161063608 19:2227167-2227189 CAAAGGAAGGGGCCTCCGGCGGG - Intronic
1161183354 19:2900342-2900364 CACGGGGCAGGGCCTCCATGGGG + Intergenic
1162081188 19:8218798-8218820 CACAGAGAAGGGCCCCCAGTGGG - Intronic
1162525168 19:11202571-11202593 CACAAGGACGTGCCTCCAGCCGG + Exonic
1162777885 19:12990526-12990548 AAGAGGGAGGGGGCTCCAAGGGG - Intergenic
1162930957 19:13957434-13957456 CCCAGGGAGGGTTCTTCAGGTGG - Intronic
1163397196 19:17070537-17070559 GAGAGGGAGGTGCCTGCAGGGGG - Intronic
1163442409 19:17328649-17328671 GAGGGGGACGGGCCTCCAGGGGG - Exonic
1163475806 19:17525514-17525536 CACAGGGACGGCTCTCCAAGGGG + Intronic
1163607248 19:18281953-18281975 CACGGGGCGGGGCCTCGGGGCGG - Intergenic
1163816276 19:19466448-19466470 CACAGGGAGAAGACTCCAGTGGG - Intronic
1163829016 19:19538962-19538984 CTAAGGGAGGGGCTTCCAGCAGG + Intronic
1164311047 19:24046781-24046803 CACTGGGTGAAGCCTCCAGGAGG - Intronic
1164658640 19:29942699-29942721 CACAGGCAGGGGCAGCCCGGCGG - Intronic
1164774441 19:30842110-30842132 CACACTGGGGTGCCTCCAGGTGG + Intergenic
1167038285 19:47007248-47007270 CACAGAGCGGGGCCCCCAGATGG - Intergenic
1167267558 19:48491185-48491207 CACAGCGGGGGGCCTGGAGGGGG + Exonic
1167356231 19:49006000-49006022 CACAGGGTTTGGCCTGCAGGAGG - Intronic
1167601732 19:50458882-50458904 CACAGGGAGGGGGCTCAGCGGGG - Intronic
1167660179 19:50791753-50791775 CACCGGGATCGGCCTCCAGCGGG - Exonic
925053884 2:840534-840556 CACAGGGAGGGTCCTGTTGGAGG + Intergenic
925101201 2:1247465-1247487 CACAGGGAGGGGCTGCTGGGAGG + Intronic
925317602 2:2937819-2937841 AAAAGGGAGGTGGCTCCAGGTGG - Intergenic
925731172 2:6920213-6920235 CAGAGGGAAAGGCTTCCAGGAGG - Intronic
926132799 2:10315494-10315516 GACAGGAAAGAGCCTCCAGGAGG + Intronic
927513092 2:23656757-23656779 CACGGGGTGGGGCCTGCAGAGGG + Intronic
928082589 2:28324077-28324099 CAGAGGGAGGGCCATCTAGGGGG + Intronic
928883439 2:36122688-36122710 CACTGGGAGGGGCCTACCTGTGG - Intergenic
929947550 2:46382102-46382124 CACAGGCCTGGGCCTCCTGGGGG + Intronic
931374390 2:61694769-61694791 AACCGGGAGGGGCCTCGTGGGGG + Intergenic
931379955 2:61743481-61743503 CACGGGCAGGGGACCCCAGGTGG + Intergenic
931869868 2:66445927-66445949 CTCCGGCAGGGACCTCCAGGCGG - Intronic
931908550 2:66869374-66869396 CTCAGGGATGGGCCTGGAGGTGG + Intergenic
932338408 2:70943932-70943954 CCCAGGGCTGGGCCTCCATGGGG - Intronic
932447106 2:71787774-71787796 CACAGGGAGATGTCTGCAGGAGG + Intergenic
933191282 2:79336751-79336773 CACAGATAGGGCCCTCCAGTTGG - Intronic
934220125 2:90074907-90074929 CACAGGGAGGGGGCTGGAGATGG - Intergenic
935237792 2:101152426-101152448 CTCAGGGAAGCGCCTCCAGAAGG + Intronic
935284194 2:101549353-101549375 CACAGGGAGGGGAAGCCAGGCGG - Intergenic
936508691 2:113128580-113128602 CACCTGCTGGGGCCTCCAGGAGG - Intronic
937040517 2:118817139-118817161 AAAAGAGAGGGGCCTCCAGCAGG + Intergenic
938538821 2:132268577-132268599 GAGAGGGAGGGGCCTCCAGAAGG + Intergenic
938944727 2:136201936-136201958 CAAAGGGAGGGGACTCAAAGAGG + Intergenic
939985906 2:148829785-148829807 CACAGAGAGGAATCTCCAGGAGG - Intergenic
941157644 2:161999007-161999029 CACTGGGAGAAGCCTCCAGAGGG + Intronic
943531152 2:189082766-189082788 CACAGTGTGGGCCCTCCATGGGG - Intronic
946117502 2:217476130-217476152 CAAAGGGAGAGGCTTCCTGGTGG - Intronic
946237031 2:218330363-218330385 CAGAGGGAGGGGCGTCTGGGGGG + Intronic
947301098 2:228689280-228689302 TGAAGGGAGGGGCCTCCAGGAGG - Intergenic
947636324 2:231682394-231682416 TCCAGGGAGGGGACTCCAGGAGG - Intergenic
947669661 2:231928166-231928188 TATAGGGAGGGGTATCCAGGTGG + Intergenic
948329534 2:237154257-237154279 CACAGGGAGGTGGCTGCAGGTGG + Intergenic
948786729 2:240356549-240356571 CACAGGGAGAGGCAGCCAGGTGG + Intergenic
948884251 2:240874995-240875017 GACGGGGTGGGGCCCCCAGGAGG - Intronic
1169197888 20:3693161-3693183 CACAGGCAGCAGCCTGCAGGAGG + Intronic
1170480839 20:16763564-16763586 CCCAGGGAGGGGCATCCACAAGG + Intronic
1171175535 20:23048965-23048987 CACAGCCAGTGGCCTGCAGGTGG + Exonic
1171423220 20:25032776-25032798 CACAGGCAGGGGCCTCAAGGAGG + Intronic
1171769016 20:29307182-29307204 GAGAGGGAGGGGCCTCCAGAAGG + Intergenic
1171812145 20:29753471-29753493 GAGAGGGAGGGGTCTCCAGAAGG + Intergenic
1171867731 20:30500538-30500560 GAGAGGGAGGGACCTCCAGAAGG + Intergenic
1171907540 20:30912206-30912228 GAGAGGGAGGGACCTCCAGAAGG - Intergenic
1172302966 20:33862894-33862916 CGCAGGGAGGGGCCTAGAGGAGG + Intergenic
1172621346 20:36320216-36320238 CACAGAGGGGGGCCTGGAGGAGG - Intronic
1172637508 20:36419898-36419920 CACAAGGATGGGACTTCAGGAGG + Intronic
1172640337 20:36436856-36436878 CTCTGGGAGGGGCTTCCACGCGG - Intronic
1173053626 20:39589561-39589583 CCCAGGGATGGGCCTCTGGGAGG + Intergenic
1173207363 20:41005599-41005621 CCCAGGAAGGAGCCGCCAGGAGG + Intergenic
1173225203 20:41158476-41158498 CACAGGGAGGGGCTGCCTGCTGG - Intronic
1174346878 20:49936649-49936671 CACCCAGAGGGGCCTCCCGGGGG + Intronic
1175260123 20:57668931-57668953 CACAGGGATGGGGGTCCTGGAGG - Intronic
1175547036 20:59785040-59785062 GACAGGGAGGGGCCATGAGGAGG + Intronic
1175549312 20:59806347-59806369 CACAGGAAAGGGCCTCCACACGG - Intronic
1175755234 20:61525423-61525445 TCCTGGGAGGGGCCTGCAGGAGG - Intronic
1175788015 20:61724054-61724076 CACAGGGTGGAGGCTCCATGCGG + Intronic
1175813716 20:61872807-61872829 CACAGAGCGGGGCCTCCACCGGG + Intronic
1175999023 20:62823975-62823997 CACAGTGACGGGACCCCAGGAGG - Intronic
1175999032 20:62824006-62824028 CACAGTGACGGGACCCCAGGAGG - Intronic
1175999067 20:62824118-62824140 CACAGAGACGGGACCCCAGGAGG - Intronic
1176027328 20:62992756-62992778 CACAGGCAGCAGTCTCCAGGTGG + Intergenic
1176119699 20:63448739-63448761 CACAGGCACGGGCATCCTGGGGG + Intronic
1176119727 20:63448817-63448839 CACAGGCATGGGCATCCTGGGGG + Intronic
1176141294 20:63546250-63546272 CACAGGAAGGGGCCTTCTGAGGG - Intronic
1176260478 20:64176868-64176890 CACAGGACGGGCTCTCCAGGCGG - Intronic
1176270077 20:64231758-64231780 CCCAGGGAGTGGCCTCTAGGTGG + Intronic
1176522957 21:7838510-7838532 CACTGGGTGGGGCCTCCCTGTGG + Intergenic
1176552712 21:8235972-8235994 GAGAGGGAGGGGCCTCCAGAAGG - Intergenic
1176571610 21:8418375-8418397 GAGAGGGAGGGGCCTCCAGAAGG - Intergenic
1176579522 21:8462938-8462960 GAGAGGGAGGGGCCTCCAGAAGG - Intergenic
1178404518 21:32313209-32313231 CACAGGGAGGGGCAGCGAGCAGG - Exonic
1178408733 21:32347034-32347056 CCCAGGGCTCGGCCTCCAGGGGG - Exonic
1178656977 21:34468522-34468544 CACTGGGTGGGGCCTCCCTGTGG + Intergenic
1178850624 21:36209437-36209459 CAAAGCCAGGGGCCTCCAGAAGG - Intronic
1179187883 21:39098544-39098566 CTCAGGGAGAGGCAGCCAGGCGG + Intergenic
1179586096 21:42375182-42375204 AAGTGGGAGGGGCCTGCAGGGGG - Intronic
1179792339 21:43762846-43762868 CATGGGGAGGGGCGTCCAGAGGG - Intergenic
1179799080 21:43802553-43802575 GGCAGGGAGAGGCCTACAGGAGG - Intronic
1180095825 21:45555065-45555087 CGCGGGGAGTGGCCACCAGGGGG + Intergenic
1180099111 21:45576110-45576132 GCCGGGCAGGGGCCTCCAGGAGG - Intergenic
1180149627 21:45940951-45940973 AGAAGGGAGGGGCCTCTAGGTGG + Intronic
1180314390 22:11265215-11265237 GAGAGGGAGGGGTCTCCAGAAGG + Intergenic
1180340969 22:11618336-11618358 GAGAGGGAGGGGCCTCCAGAAGG - Intergenic
1180967058 22:19795876-19795898 CTCAGGCAGGGGCCTCTTGGTGG - Intronic
1181041590 22:20195029-20195051 CCCAGGGGAGGGCCTGCAGGGGG - Intergenic
1181104795 22:20567797-20567819 TGCATGGAGGGGCCTCCAGAAGG - Intronic
1181163955 22:20973689-20973711 CACTGGGAGGAGCTGCCAGGAGG + Intronic
1181562772 22:23715294-23715316 CACACGGTGGGGACTCCTGGTGG + Intergenic
1181847368 22:25722459-25722481 AACAGGGAGGGTCCTCGAGGAGG + Exonic
1182317931 22:29460121-29460143 GACAGGGAGGGGACCCCAGATGG + Intergenic
1183395193 22:37567486-37567508 GGCAGGGAGTGGCCACCAGGTGG - Intronic
1183654092 22:39175132-39175154 AACCGTGAGGGGCCCCCAGGTGG + Intergenic
1183720595 22:39559488-39559510 CAGAGGGAGGGGACACCAGTGGG + Intergenic
1184036534 22:41920721-41920743 CAGAGGCTGGGGGCTCCAGGAGG - Intergenic
1184398910 22:44262206-44262228 GACAGGGAGGGCACTCCAGGCGG + Intronic
1184773329 22:46610552-46610574 CACAGGGAGCGGCTCCTAGGTGG - Intronic
1184799342 22:46750502-46750524 CTCAGGGAGGGGCCCACAGGAGG + Intergenic
1184897138 22:47416511-47416533 CACAGGGTGGGGCCCCTAAGAGG + Intergenic
1185066149 22:48632642-48632664 CACAGAGAACGGCCTCCAGAGGG - Intronic
1185109775 22:48894476-48894498 CACAGAGCGGGGACTCCACGTGG - Intergenic
1203257691 22_KI270733v1_random:152374-152396 GAGAGGGAGGGGCCTCCAGAAGG - Intergenic
949480757 3:4492492-4492514 CACAGAGATGCGCATCCAGGCGG - Intergenic
949935002 3:9109801-9109823 CACAGGGAGGAGCCTTCAAAGGG + Intronic
950310077 3:11949513-11949535 CAGTTGGAGGAGCCTCCAGGTGG - Intergenic
950543635 3:13626600-13626622 CATGGGGCGGGGCCTCCAGTTGG - Intronic
950614279 3:14146818-14146840 CCCAGGGAGGGGCCCCCTTGAGG + Intronic
951087134 3:18526204-18526226 AACAGGGAGGGGAACCCAGGTGG - Intergenic
951837630 3:27001024-27001046 CAAAGGGAGGGGGCTCAAAGAGG - Intergenic
954148428 3:48645744-48645766 CACGGGGAGAGGCATCCATGAGG + Exonic
954331279 3:49891710-49891732 CAGAGGGAGGGGCCTCAGGCTGG - Intronic
954686055 3:52370853-52370875 CACAGGGAGGGACCACTGGGTGG + Intronic
954750114 3:52808743-52808765 CACAGAGAGGGGCCTGTGGGAGG + Exonic
954787243 3:53102850-53102872 CACAGGGCGTTGCCTCAAGGAGG - Intronic
955022459 3:55134246-55134268 CACAGGGATGGGGCTGCAGGTGG - Intergenic
955056259 3:55458491-55458513 CACTGGGAGGGGGCTCCTGAAGG - Intergenic
955566758 3:60255697-60255719 AACAGTCAGTGGCCTCCAGGAGG + Intronic
956386475 3:68725056-68725078 CACTGGGAGGGGTGTCCTGGTGG - Intergenic
956584165 3:70846412-70846434 CACAGGGAGGGGCCGGTTGGGGG - Intergenic
958016761 3:87946351-87946373 CAAAGGGAGGGGCCCCAAAGAGG + Intergenic
959666053 3:108922832-108922854 CACAGGGAGGGGCCTGTCGGCGG - Intronic
961041804 3:123683228-123683250 CCCAGGGAGGGGGCTTCAAGGGG - Intronic
961244112 3:125436670-125436692 CAGAGTTAGGGACCTCCAGGTGG - Intergenic
961551258 3:127671825-127671847 GCCAGGGAGGGGCCCCCTGGTGG - Intronic
962601062 3:136991074-136991096 CTCAGGGAGGGGCATGGAGGTGG + Intronic
963570661 3:146990952-146990974 CACAAGGAGGGGACTCTAGGGGG - Intergenic
964443205 3:156733163-156733185 AACAGTGAGGTGGCTCCAGGGGG - Intergenic
965123681 3:164595870-164595892 CACAGGGTGGGGGCTGCTGGTGG + Intergenic
966887283 3:184383637-184383659 CACACGGTGAGGGCTCCAGGTGG + Exonic
968039912 3:195580059-195580081 AACAGGGAGCGGCCTGCTGGGGG + Intronic
968357952 3:198122902-198122924 AACAACCAGGGGCCTCCAGGTGG - Intergenic
968518904 4:1027001-1027023 CCCAGCGAGGGGACTCCAAGAGG - Intergenic
968736133 4:2297420-2297442 CACACGGAGGAGTCGCCAGGTGG + Intronic
968901890 4:3435896-3435918 CCCAGGGAGGGGCTTCAAGCCGG - Intronic
969292643 4:6250582-6250604 CACAGGGAAGCGCCTCCTGTGGG + Intergenic
969597827 4:8158880-8158902 CGCGGGGCGGGGCCGCCAGGAGG - Intergenic
970303065 4:14702114-14702136 CCCTGGGAGGGGCTTGCAGGAGG + Intergenic
970738127 4:19198255-19198277 CAAAGGGAGGGGACTCAAAGAGG + Intergenic
971574263 4:28253927-28253949 CACTGGGTGGGGCCTCCCTGTGG + Intergenic
973640063 4:52893673-52893695 CCCAGGGAAGGGCCTCTAGTTGG - Intronic
976130666 4:81880597-81880619 CACAGGCTGGGGCCACCTGGAGG + Intronic
978327914 4:107579636-107579658 CACTGGGTGGGGCCTCCCTGTGG + Intergenic
979136023 4:117114021-117114043 CAAAGGGAGGGGACTCAAAGGGG + Intergenic
980053713 4:128061246-128061268 CACGGGGCGGGGCCTCCCTGAGG - Exonic
980093313 4:128464568-128464590 AACAGAGATGGGACTCCAGGGGG - Intergenic
984699593 4:182809929-182809951 CCCCGAGAGGGCCCTCCAGGGGG + Intergenic
985233754 4:187850165-187850187 CAGAGGGGAGGGCCTCCAAGAGG - Intergenic
985571412 5:647541-647563 CACAGGGATGTGGCTCCATGGGG + Intronic
986349871 5:6867400-6867422 CACAGGGAGGGGCTTACACCAGG + Intergenic
986753578 5:10812448-10812470 CACTGGGTGGGGCCTCCCTGTGG + Intergenic
987740887 5:21907450-21907472 CAAAGGGAGGGCCTTGCAGGTGG + Intronic
993413825 5:87601654-87601676 CACAGTGAGGAGCTTCCAGAGGG + Intergenic
995405215 5:111787125-111787147 CACAGGGAGGGGTATCCAGCAGG - Intronic
996024163 5:118625170-118625192 GAAAGGAAGGGGCCTGCAGGAGG - Intergenic
997585957 5:135043631-135043653 CCTAGGGAGGGGTCCCCAGGTGG - Intronic
997662952 5:135603534-135603556 CACAGGGAGGGGCCGTCAGAGGG - Intergenic
998168609 5:139859020-139859042 CAGAGGGTGGGGGCTCCAGTGGG - Intronic
998533876 5:142911094-142911116 CACAGGGTCTGGTCTCCAGGAGG - Intronic
999443432 5:151620377-151620399 CACAGGAAGGGGCCTCGACTAGG + Intergenic
999486040 5:151997546-151997568 TGCAGGCAGGGGCCTCCAAGTGG + Intergenic
1001426413 5:171625526-171625548 CACTGGTAGGGGCCGGCAGGAGG - Intergenic
1001444029 5:171769323-171769345 CACATGGAGGGGCTTCTGGGTGG + Intergenic
1002414741 5:179114067-179114089 CATTGAGAGGGACCTCCAGGGGG + Exonic
1004688189 6:17968279-17968301 CACAGGCAATGGACTCCAGGTGG + Intronic
1007175398 6:39892883-39892905 CACAGCAAGGGACCTGCAGGTGG + Intronic
1013462106 6:110384736-110384758 CACAGAGAGGGGCCTGTTGGGGG + Intergenic
1013796758 6:113896996-113897018 CAAAGGGAGGGGACTCAAAGAGG + Intergenic
1016444189 6:144116367-144116389 CAAAGGGAGGGGACCCCAAGGGG + Intergenic
1017497030 6:154992348-154992370 CACAGGGAGGCGTCTCATGGAGG - Intronic
1017978177 6:159375837-159375859 CGCAGGGAGGGGCAGTCAGGAGG + Intergenic
1018174974 6:161170701-161170723 CACAAGAAGGGGCTGCCAGGTGG - Intronic
1018644115 6:165931916-165931938 CGCAGGGTGTGGCCTCCTGGTGG - Intronic
1018760541 6:166891089-166891111 CAAAGGGAGGGGACTCAAAGAGG - Intronic
1018892891 6:167995443-167995465 CACACAGAGGGGTCCCCAGGCGG + Intergenic
1019276784 7:180038-180060 CAAATGGAGGGGCCTGCGGGGGG + Intergenic
1019281667 7:203411-203433 CCCAGGAAGGGGCCAGCAGGTGG - Intronic
1019286055 7:223681-223703 CACAGGGAGGGGCCCTTACGCGG + Intronic
1019305678 7:333187-333209 CCCAGGGAGGGGCCGGCGGGGGG + Intergenic
1019357111 7:586275-586297 CACAGGGTGTGGACACCAGGAGG - Intronic
1019493131 7:1324353-1324375 CCCAGGGAGGCGCTTCCCGGGGG - Intergenic
1019701771 7:2477664-2477686 GGCCGGGAGGGGCCTCAAGGTGG + Intergenic
1019716674 7:2542437-2542459 GATACTGAGGGGCCTCCAGGAGG + Intronic
1020402806 7:7797246-7797268 CACAGGGAGGGTACTTCATGAGG + Intronic
1021885355 7:25132078-25132100 CACAGGGAGGGGACCCAAAGAGG + Intergenic
1022703878 7:32785487-32785509 CACAGCTGGAGGCCTCCAGGAGG - Intergenic
1022908122 7:34875616-34875638 CACAGCTGGAGGCCTCCAGGAGG - Intronic
1023114006 7:36842468-36842490 CTCAAGGGGGGGCCTCCAAGTGG + Intergenic
1023852542 7:44158455-44158477 CACTGGGAGGGGCCGGCTGGTGG + Intronic
1023967555 7:44970796-44970818 CACAGGGAGGGAAGCCCAGGAGG - Intronic
1024055440 7:45657428-45657450 GTCAGGGAGGGCCCTCTAGGAGG + Intronic
1026896570 7:74013146-74013168 CATAGGGAGGGGCCTAGAGGCGG + Intergenic
1026910818 7:74090790-74090812 CACTGGGAGGGGCATGCAGAGGG - Intronic
1029001228 7:97156981-97157003 CACAGGGAGGGGCCTGTCAGGGG - Intronic
1029607579 7:101608471-101608493 GGGAGAGAGGGGCCTCCAGGAGG + Intergenic
1030114084 7:106050117-106050139 CAAAGGTAGGGGCATCCAAGAGG + Intergenic
1031018238 7:116598455-116598477 CACACGGAGAGGCCACGAGGAGG + Intergenic
1033563075 7:142552747-142552769 AACAGGGAGGGGGCTCTAGCAGG + Intergenic
1035068155 7:156122768-156122790 CACAGGGAGACGTCTCTAGGAGG + Intergenic
1037802963 8:22044976-22044998 CACAGGCAGCGGCATCCAGGTGG + Intronic
1037949049 8:23007019-23007041 CGCAGAGCGGGTCCTCCAGGAGG - Exonic
1040280185 8:46036915-46036937 GAGAGGGAGGGGCCTCCAGGAGG + Intergenic
1040527248 8:48235994-48236016 CAAAGGGAGGGGACTCAAAGGGG + Intergenic
1041474554 8:58249117-58249139 CACTGGGCGGGGCCTCCCTGTGG + Intergenic
1041770944 8:61471918-61471940 GCCCGGGAGGGGCCTGCAGGAGG - Intronic
1044370044 8:91399591-91399613 CACAGGGTGGTTCCACCAGGTGG + Intergenic
1048472179 8:134713213-134713235 CCCAGGGAGGGGCCCTCGGGAGG + Intergenic
1048534110 8:135276488-135276510 CACTGGGAGGGGCCTCATGGAGG + Intergenic
1048961946 8:139587336-139587358 CACACAGTGGAGCCTCCAGGTGG + Intergenic
1049173538 8:141177045-141177067 CAGAGAGTGGGGCCTCCCGGGGG + Intronic
1049236429 8:141514628-141514650 GACGGGGAGGGGCCTCCCAGGGG - Exonic
1049365576 8:142235278-142235300 CACAGGCAGGGTCCGGCAGGTGG + Intronic
1049373547 8:142278807-142278829 CAGAGGGAGGGGCCTGCAGAAGG + Intronic
1049607273 8:143535596-143535618 CTGGGGGAGCGGCCTCCAGGCGG - Intronic
1049665542 8:143841112-143841134 CGCGGGGCGGGGCCTCCGGGGGG - Intergenic
1049665660 8:143841413-143841435 CGCAGGGCGGGGCCTCCGAGGGG - Intergenic
1049725410 8:144143398-144143420 GACACGGAGGGGCCTGCTGGGGG + Intergenic
1049807159 8:144546277-144546299 GGCAGGGAGGGGCCTCCTGGAGG - Intronic
1049962153 9:747189-747211 GAGAGGGATGTGCCTCCAGGTGG - Intergenic
1054704067 9:68444922-68444944 CACAGGGATTGGCCTTCAGCTGG + Intronic
1054810490 9:69430304-69430326 GGCAGGGAGGGGAGTCCAGGAGG + Exonic
1054910452 9:70450519-70450541 AAAAGGGAGGTGCCTCCATGGGG - Intergenic
1056618608 9:88191128-88191150 CGCAGGGAGGGGCAACCAGGCGG - Intergenic
1059200275 9:112408266-112408288 GACAGGGAGGGACAACCAGGAGG + Intronic
1059245846 9:112848917-112848939 CACAGCGTGGGGGCTCCTGGGGG - Intronic
1059307873 9:113368799-113368821 CACAGGGTGGGGCCCACAGTTGG - Intronic
1059423512 9:114206881-114206903 CTCAGGAGGGGGCCACCAGGTGG + Intronic
1059435882 9:114275969-114275991 CACAGGGCAGGGCAGCCAGGAGG - Intronic
1060187670 9:121573888-121573910 CACAGGGAGGGGCCTCCAGGTGG - Intronic
1061178997 9:129013111-129013133 CAGTGGGAGGGGACACCAGGCGG + Intronic
1061386885 9:130295661-130295683 CACAGGGAGGATCCTGCAGGAGG + Intronic
1062027371 9:134346788-134346810 CTGAGGGAGGGTCCTCCTGGAGG + Intronic
1062275466 9:135728411-135728433 CCCAAGGAGGGGCCTGCGGGTGG - Intronic
1062359047 9:136178779-136178801 AACGGGGAGGGGGCCCCAGGAGG - Intergenic
1062363150 9:136197113-136197135 CACAGGGCTGGCCCGCCAGGTGG - Exonic
1062585230 9:137246242-137246264 CACACGCAGGGCCCACCAGGAGG + Intronic
1062722848 9:138053532-138053554 CACAGGGAGGGGCCGGAAGCAGG - Intronic
1062736294 9:138139462-138139484 CTCAGGGAGGGGCTTCCAGGAGG - Intergenic
1203473883 Un_GL000220v1:134396-134418 GAGAGGGAGGGGCCTCCAGAAGG - Intergenic
1203362697 Un_KI270442v1:231336-231358 GAGAGGGAGGGGTCTCCAGAAGG + Intergenic
1186892644 X:13974723-13974745 AACAGGGAGTGACATCCAGGAGG - Intergenic
1187442043 X:19329285-19329307 CAGAGGGAGGGCTCTCCTGGGGG - Intergenic
1187478627 X:19634620-19634642 CACTTGGAGGGGCCACAAGGAGG + Intronic
1189102766 X:38208305-38208327 CACTGGGAGGGGCCACAAGGGGG - Intronic
1189373651 X:40449418-40449440 CTCAGGGAGCCGGCTCCAGGCGG - Intergenic
1191107570 X:56781025-56781047 CAAAAGGAGGGGCCCCGAGGTGG - Intergenic
1192369087 X:70498648-70498670 CAGAGGGAGGGACCTGGAGGAGG + Intronic
1192455282 X:71270773-71270795 CAAGGGGAGGGTCCTGCAGGTGG - Intergenic
1196424937 X:115560994-115561016 CACGGGGATGGGCACCCAGGAGG - Intergenic
1196761317 X:119203116-119203138 CACAGGTAGGGACTTCCAAGGGG + Intergenic
1198505585 X:137297873-137297895 CAAAGGGCGGGACCTCCAGGTGG + Intergenic
1198933025 X:141880123-141880145 CACAGGGAGCTGCCTCCAGTTGG + Intronic
1198958362 X:142156741-142156763 CACAGGGCGGGGCCTCTCTGTGG + Intergenic
1199755736 X:150863292-150863314 CATAGGGAGGGGCTTCCAGTAGG + Intronic
1200205038 X:154309576-154309598 CACAGGGAAGGCCTTCCAGAGGG - Intronic
1200398530 X:156005567-156005589 CTCGGGGAGGGGCTTACAGGAGG - Intronic
1201075549 Y:10184874-10184896 GAGAGGGAGGGGCCTCCAGAAGG - Intergenic
1201766382 Y:17576883-17576905 GAGAGGGAGGGGCCTCCAGAAGG + Intergenic
1201835170 Y:18329106-18329128 GAGAGGGAGGGGCCTCCAGAAGG - Intergenic