ID: 1060187927

View in Genome Browser
Species Human (GRCh38)
Location 9:121575188-121575210
Sequence TGTTAAGTACAGTTCAGGAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 124
Summary {0: 1, 1: 0, 2: 2, 3: 7, 4: 114}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1060187927_1060187933 -9 Left 1060187927 9:121575188-121575210 CCCCTCCTGAACTGTACTTAACA 0: 1
1: 0
2: 2
3: 7
4: 114
Right 1060187933 9:121575202-121575224 TACTTAACACCCCCAGGCCTGGG No data
1060187927_1060187932 -10 Left 1060187927 9:121575188-121575210 CCCCTCCTGAACTGTACTTAACA 0: 1
1: 0
2: 2
3: 7
4: 114
Right 1060187932 9:121575201-121575223 GTACTTAACACCCCCAGGCCTGG No data
1060187927_1060187940 30 Left 1060187927 9:121575188-121575210 CCCCTCCTGAACTGTACTTAACA 0: 1
1: 0
2: 2
3: 7
4: 114
Right 1060187940 9:121575241-121575263 CTCCGTGTGACCTGTGAGCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1060187927 Original CRISPR TGTTAAGTACAGTTCAGGAG GGG (reversed) Intronic
909928797 1:81471097-81471119 TGTTAAGCACATTGCAGGATTGG + Intronic
911517502 1:98885313-98885335 TATTAAATACAGGCCAGGAGCGG + Intergenic
911633644 1:100209881-100209903 TGATAAGTAAACTTCAGGAAAGG + Intronic
912453322 1:109781003-109781025 TGTTAAGAGCAGTTCTGGTGTGG - Intergenic
914329278 1:146650797-146650819 GCTTAGGTACAGTTCAGTAGGGG - Intergenic
915693048 1:157709870-157709892 TGTTAAATAGAGCTCAGGAAAGG + Intergenic
919294616 1:195680266-195680288 GGTTAAGATCAGTTGAGGAGTGG - Intergenic
921699835 1:218256100-218256122 TGTTACCTACAGCTCAGGTGAGG + Intergenic
922036613 1:221854474-221854496 TGTTAGGAACAGTTCCAGAGAGG + Intergenic
923920258 1:238556176-238556198 TGTCTTGTACAGTTCAGGATTGG + Intergenic
1063598446 10:7458659-7458681 TGACAAGTACAGTGAAGGAGTGG - Intergenic
1064508579 10:16063933-16063955 TGTTAATTATAGTTCAGCACTGG + Intergenic
1065997815 10:31075564-31075586 TGTTACTCACATTTCAGGAGGGG + Intergenic
1067228058 10:44388069-44388091 TGTTAAGCACAGTTCAAGGTGGG + Intergenic
1069424329 10:68276553-68276575 TGTCTAGTACAGGCCAGGAGGGG - Intergenic
1070002354 10:72389128-72389150 GGATTATTACAGTTCAGGAGTGG + Intronic
1071838449 10:89443699-89443721 TGTCATATACAGTTCAAGAGTGG + Intronic
1074268524 10:111929471-111929493 TGTTAGGTCCAGCTCATGAGGGG - Intergenic
1074458905 10:113619359-113619381 TGTTCATTCTAGTTCAGGAGAGG - Intronic
1078615603 11:12862567-12862589 TTTGAAATACAGTACAGGAGCGG - Intronic
1083078733 11:60068593-60068615 TTCTAAGTAGAGTTCAGAAGAGG - Intronic
1084432211 11:69117409-69117431 CTTTCCGTACAGTTCAGGAGGGG - Intergenic
1084927668 11:72526681-72526703 TGTTAAGTAAAATTCATGGGAGG + Intergenic
1085841743 11:80019322-80019344 ACTTAAGTGCAGTTCAGGAGAGG + Intergenic
1091106865 11:132929934-132929956 TGTTGAGTACATTTTAGTAGTGG - Intronic
1099778424 12:87164021-87164043 TGTTAAAGCCAGTTCTGGAGAGG - Intergenic
1108570626 13:51746235-51746257 TGAAAAGTCCAGTTCAGCAGTGG - Intronic
1108582278 13:51837741-51837763 TGGTAAGTACAGGTAAGGAAAGG + Intergenic
1111266010 13:85814383-85814405 TGATAAGGACAGTTCAAAAGTGG - Intergenic
1112916485 13:104556671-104556693 TGTTTAGTGCACTTGAGGAGTGG - Intergenic
1116999245 14:51355408-51355430 TCTTATGTACAAGTCAGGAGAGG - Intergenic
1117287493 14:54301107-54301129 TGTGAGGTACAGTGGAGGAGGGG + Intergenic
1125135455 15:36336030-36336052 TGTTTGCTACAGTTTAGGAGGGG - Intergenic
1125677233 15:41508950-41508972 TCTTCAGTGCAGTGCAGGAGTGG + Intronic
1126638054 15:50798316-50798338 TGTGAAGTTCAATTCAGTAGTGG + Intergenic
1128270101 15:66301569-66301591 AGTCAAGTACAGGTCAGGTGTGG - Intronic
1131308825 15:91269361-91269383 TGCTAAGTACAGTTCAGGAAGGG - Intronic
1131366085 15:91842304-91842326 TGTCAGATACAGTTGAGGAGTGG + Intergenic
1132783601 16:1642164-1642186 GGGTAAGGACTGTTCAGGAGTGG - Intronic
1132787635 16:1666746-1666768 TGTGTAGTACAGAGCAGGAGAGG + Intronic
1137974813 16:53022401-53022423 TGAAAAGTCCAGTTAAGGAGTGG + Intergenic
1140004286 16:71060136-71060158 GCTTAGGTACAGTTCAGTAGGGG + Intronic
1153768811 18:8399420-8399442 TGTTACATAAAGTTCATGAGAGG - Intronic
1153908501 18:9685508-9685530 TGGTAGGTAAATTTCAGGAGTGG + Intergenic
1157623317 18:49028368-49028390 TCTGGAGTACAGCTCAGGAGTGG - Intergenic
1157976083 18:52328486-52328508 TGATAAGTGCAGTAAAGGAGAGG + Intergenic
1159183322 18:64939157-64939179 TTCTAATTACATTTCAGGAGAGG - Intergenic
1159388705 18:67760060-67760082 TATTAAGTACAGTGAAGGAGAGG - Intergenic
1159536859 18:69725781-69725803 TTTTAAATACACTTCAGGGGTGG - Intronic
928012668 2:27624856-27624878 TGTAAAGTATAGTTGAGGAATGG - Intergenic
929247997 2:39723193-39723215 AGTGAAGTTCAGTTCAGGCGTGG - Intergenic
933493843 2:83022591-83022613 TGTTAAATACAGTTTTGTAGTGG - Intergenic
933762498 2:85681966-85681988 AGTTATGGACAGTTCAGGTGAGG + Intergenic
938095250 2:128457225-128457247 TGTGAAGCACAGGTCAGGAGGGG - Intergenic
941010741 2:160297002-160297024 TGTTGGGTACAGGTCTGGAGAGG - Intronic
941400349 2:165022707-165022729 TGTTACGCACAGTTCCAGAGAGG + Intergenic
941759263 2:169223300-169223322 TGTTAGGTACAATGCAGTAGTGG - Intronic
941981104 2:171458018-171458040 TGTGATGTACAGCTCAGGACTGG + Exonic
1175026905 20:55912417-55912439 TGAAAAGTACAGTTCAAAAGGGG - Intergenic
1175419993 20:58825590-58825612 TGTGAAGTGCAGTTCAGTATTGG + Intergenic
1177371666 21:20212095-20212117 TGATAAATACAGTTAAGGACTGG + Intergenic
1178058532 21:28826254-28826276 TGATAAGTACACATCAGTAGGGG + Intergenic
1178233453 21:30813880-30813902 TGTTAGGTATAGTTTAGGAGGGG - Intergenic
1178553711 21:33567245-33567267 TGTTAAATAGAGCTCAGGAAAGG + Exonic
1178848230 21:36191446-36191468 TGGTCAGTTCAGTCCAGGAGGGG + Intronic
949249372 3:1964321-1964343 TGTTAAAAAGAGTTAAGGAGTGG - Intergenic
949396316 3:3617770-3617792 TGTTACGTACAGTTCCCAAGAGG - Intergenic
954765859 3:52915615-52915637 AGTTAAGAATAGTTCAAGAGAGG + Intronic
955500889 3:59581577-59581599 TGTTAAATAGATTTCAGGTGAGG + Intergenic
958900491 3:99880314-99880336 TTTTAAGTACAGTTTAAGTGCGG - Intronic
959562396 3:107797652-107797674 TTTTAAGTTAAGGTCAGGAGGGG + Intronic
959795844 3:110427573-110427595 TAGTAAGTCCAGTTCAAGAGGGG + Intergenic
960317638 3:116197807-116197829 TGATATATACAGTTCAGTAGTGG + Intronic
967807494 3:193728711-193728733 TGTTATGTACAGTCCAGGATGGG + Intergenic
969268270 4:6080363-6080385 TGTTAGGGACAGTGCTGGAGTGG + Intronic
969881120 4:10174858-10174880 TGTTATGCATAGTCCAGGAGAGG + Intergenic
970779611 4:19720306-19720328 TGATAAGTGCAGTGCAGGATAGG - Intergenic
971025322 4:22583819-22583841 TCTTAAGCACAGTTCAGCAATGG - Intergenic
974705068 4:65503694-65503716 TGTTCAGTACAGTTCATGGCAGG - Intronic
977894930 4:102352586-102352608 TGTTAAGTACAGGCCGGGTGCGG - Intronic
978339743 4:107709708-107709730 TGTTAAGTACACTTCTGGTTGGG - Intronic
978905665 4:114002526-114002548 TGTTAAGTAAAGTTTATGACTGG + Intergenic
981745934 4:148052469-148052491 TGTAAATTTCAGGTCAGGAGAGG + Intronic
988198129 5:28033755-28033777 TGTGAAGTTCTGTTGAGGAGTGG - Intergenic
988863021 5:35304281-35304303 ATTTAAGAATAGTTCAGGAGAGG + Intergenic
989232234 5:39099665-39099687 TGTTTAGTACAGTTCTGGAGAGG - Intergenic
990614068 5:57489132-57489154 TGTGAGGTGCAGTTCAGGGGAGG + Intergenic
992169601 5:74088635-74088657 TATTACTTACAGTTCTGGAGTGG + Intergenic
996458809 5:123717220-123717242 TGTTAAATAAAGTTTATGAGAGG + Intergenic
999434894 5:151555799-151555821 AGTGAAGGACAGCTCAGGAGGGG + Intronic
1005396629 6:25388971-25388993 TGTTAAGTAGAGGCCAGGTGTGG - Intronic
1007924229 6:45638625-45638647 TGTTCAGTAGTGTTGAGGAGAGG + Intronic
1008068418 6:47074835-47074857 GGTTAAGTAAAGGTGAGGAGGGG + Intergenic
1012375219 6:98554120-98554142 TGTCAAGGACAGCACAGGAGAGG + Intergenic
1018496230 6:164348040-164348062 TGTTTATTGCAGCTCAGGAGTGG + Intergenic
1021157588 7:17230824-17230846 TGTTAGGAACAGTTCTGGATTGG - Intergenic
1021279173 7:18695712-18695734 TGTTAAAGAAAGTTCAGGTGAGG - Intronic
1021550589 7:21867343-21867365 TGTAAAGTAGAGTTCAGCAGAGG - Intronic
1024477844 7:49832730-49832752 TGTTAAACACAGTTGATGAGAGG - Intronic
1031303622 7:120096342-120096364 TGTTAAATACAGAGCAGGATTGG - Intergenic
1031349725 7:120715651-120715673 TGTGATGTACTGTTCAGTAGTGG - Intronic
1034345922 7:150385044-150385066 TGTTAAGTCCAGTTGGTGAGAGG + Intronic
1037323861 8:17669553-17669575 TGTCCAGTACAGGCCAGGAGTGG + Intronic
1043608279 8:82029403-82029425 TGGTAATTATAGTTCAGGATAGG - Intergenic
1043634711 8:82372805-82372827 TGTAATGTCCAGATCAGGAGAGG - Intergenic
1044491170 8:92817048-92817070 TGTACAGTACAGTGCAGGAGAGG - Intergenic
1044639622 8:94365091-94365113 TGTTTCTTACAGTTCTGGAGCGG - Intergenic
1044977977 8:97684619-97684641 TGTCAACTACAGTTGAGCAGAGG - Intronic
1045055236 8:98363016-98363038 TGTTATCTACAGTCCAGGAAAGG + Intergenic
1047226817 8:122961992-122962014 TGTTAATTGCATCTCAGGAGGGG + Intronic
1047609667 8:126508771-126508793 TGCTAAGCACAGTCCGGGAGAGG - Intergenic
1048422916 8:134294870-134294892 TGCAAAGCACAGTTCAGAAGTGG + Intergenic
1050478960 9:6069853-6069875 GGTTAAGAACAGTTCAGGGCCGG - Intergenic
1056377087 9:86025111-86025133 TGTTTGGAAAAGTTCAGGAGAGG + Intergenic
1060187927 9:121575188-121575210 TGTTAAGTACAGTTCAGGAGGGG - Intronic
1060606182 9:124916191-124916213 TGTTAAGTACAATACAGGTTAGG + Intronic
1187765513 X:22637369-22637391 TGGGAAGTACAGTTCTGGTGAGG + Intergenic
1193345971 X:80405226-80405248 TGTTAAGAAAATTTCAGGGGAGG + Intronic
1193725301 X:85031646-85031668 TGTTAGGTACAGGAGAGGAGAGG + Intronic
1195589983 X:106612816-106612838 TGTTAATTACAAGCCAGGAGTGG + Intronic
1196795547 X:119499598-119499620 TTTTAAGTATAGGACAGGAGCGG + Intergenic
1200300476 X:154969476-154969498 TATTGAGTGCACTTCAGGAGTGG + Exonic
1200609626 Y:5311620-5311642 TGTTCAGCACAGATGAGGAGAGG + Intronic
1201888694 Y:18917499-18917521 TGTTAAGTTTAATTCTGGAGAGG - Intergenic