ID: 1060187927

View in Genome Browser
Species Human (GRCh38)
Location 9:121575188-121575210
Sequence TGTTAAGTACAGTTCAGGAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1060187927_1060187933 -9 Left 1060187927 9:121575188-121575210 CCCCTCCTGAACTGTACTTAACA No data
Right 1060187933 9:121575202-121575224 TACTTAACACCCCCAGGCCTGGG No data
1060187927_1060187932 -10 Left 1060187927 9:121575188-121575210 CCCCTCCTGAACTGTACTTAACA No data
Right 1060187932 9:121575201-121575223 GTACTTAACACCCCCAGGCCTGG No data
1060187927_1060187940 30 Left 1060187927 9:121575188-121575210 CCCCTCCTGAACTGTACTTAACA No data
Right 1060187940 9:121575241-121575263 CTCCGTGTGACCTGTGAGCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1060187927 Original CRISPR TGTTAAGTACAGTTCAGGAG GGG (reversed) Intronic