ID: 1060187928

View in Genome Browser
Species Human (GRCh38)
Location 9:121575189-121575211
Sequence GTGTTAAGTACAGTTCAGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 145
Summary {0: 1, 1: 0, 2: 3, 3: 14, 4: 127}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1060187928_1060187940 29 Left 1060187928 9:121575189-121575211 CCCTCCTGAACTGTACTTAACAC 0: 1
1: 0
2: 3
3: 14
4: 127
Right 1060187940 9:121575241-121575263 CTCCGTGTGACCTGTGAGCCAGG No data
1060187928_1060187933 -10 Left 1060187928 9:121575189-121575211 CCCTCCTGAACTGTACTTAACAC 0: 1
1: 0
2: 3
3: 14
4: 127
Right 1060187933 9:121575202-121575224 TACTTAACACCCCCAGGCCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1060187928 Original CRISPR GTGTTAAGTACAGTTCAGGA GGG (reversed) Intronic
900929556 1:5727851-5727873 GTGTGAAGGACACTTCAGCAGGG + Intergenic
903015911 1:20361771-20361793 GTGGTTAGTTCAGTTCGGGATGG - Intergenic
906180271 1:43811808-43811830 GTGTTATGAACAGGGCAGGATGG - Intronic
907854124 1:58284490-58284512 GTATTAAGCACAGATCTGGAAGG + Intronic
914200933 1:145484830-145484852 GTGTAAATTACAGCACAGGAAGG - Intergenic
914329279 1:146650798-146650820 GGCTTAGGTACAGTTCAGTAGGG - Intergenic
914480046 1:148057958-148057980 GTGTAAATTACAGCACAGGAAGG - Intergenic
917529348 1:175820450-175820472 GTATTAAGTACACTTCTGGCAGG + Intergenic
918101729 1:181382233-181382255 GTTCTCAGAACAGTTCAGGAGGG + Intergenic
924078397 1:240365832-240365854 GTGTTAAGTAAAGTTCATTAAGG - Intronic
924656544 1:245977783-245977805 GTGTTAATAACAGGGCAGGAAGG - Intronic
1065379904 10:25079383-25079405 GTCTTAAGTAAATGTCAGGAGGG - Intergenic
1065438251 10:25723775-25723797 GTTTTAAGTATAATACAGGAGGG + Intergenic
1065979953 10:30883904-30883926 GTGTTAGTTACAGATCAGTATGG + Intronic
1066492588 10:35907768-35907790 GTGTGAATTCCAATTCAGGAGGG - Intergenic
1067228057 10:44388068-44388090 TTGTTAAGCACAGTTCAAGGTGG + Intergenic
1069304403 10:66951032-66951054 GTGATAAATACAGTGCAGCAAGG - Intronic
1069424330 10:68276554-68276576 GTGTCTAGTACAGGCCAGGAGGG - Intergenic
1070752030 10:78969554-78969576 ATGTTAAGCACAGTACAGGAAGG + Intergenic
1071424929 10:85539902-85539924 GTCAGAAGTCCAGTTCAGGAGGG + Intergenic
1073330522 10:102667571-102667593 GCGATAAGTACAGTCCAGGAAGG + Intergenic
1074372907 10:112914773-112914795 GTGTTAAGTCCAGTACAGAGTGG + Intergenic
1077794128 11:5472925-5472947 GTGTTAAAACCAGTACAGGATGG - Intronic
1080407318 11:31990950-31990972 GCGTTATGTTCAGTTGAGGAAGG + Intronic
1080879818 11:36309140-36309162 GTGTTAAGTATGGCTCAGGGAGG + Intronic
1082189295 11:49223429-49223451 TTGTAAAGTACAGTACTGGAGGG - Intergenic
1085555651 11:77418420-77418442 GTATTAAGTACAGTTAAAGGAGG - Intronic
1086677226 11:89623069-89623091 CTGTAAAGTACAGTACTGGAGGG + Intergenic
1087339402 11:96883625-96883647 GTGGTAACTACAGGTTAGGAAGG + Intergenic
1089634218 11:119802024-119802046 GTGTTATGCCAAGTTCAGGAGGG + Intergenic
1089789100 11:120929660-120929682 GTGTTAATTACAGCCCGGGAAGG - Intronic
1090516021 11:127427913-127427935 GTGTTAAGTCCACTTCAAGTTGG - Intergenic
1090925656 11:131248379-131248401 ATGTTAAATTCAGTTCAGAATGG - Intergenic
1094086836 12:26602675-26602697 ATTTTAAGTCCAGTGCAGGATGG - Exonic
1095666672 12:44810018-44810040 GAGTTAAGGACATTTCAGGATGG + Intronic
1097603490 12:61724110-61724132 GTATATATTACAGTTCAGGATGG + Intronic
1098897419 12:76080004-76080026 GTTTTTAGTTCAGTTTAGGAAGG - Intronic
1101658207 12:106742961-106742983 GTTTTAAGCACAGGACAGGAAGG - Intronic
1104971455 12:132532701-132532723 GTGTTAAGCGCAGTGCAGGAGGG + Intronic
1108332759 13:49406474-49406496 GTGTTAAGAACATTCCAGGCTGG - Intronic
1109899988 13:68755130-68755152 GTGTTAAGTACATTTCAATGCGG - Intergenic
1111089915 13:83431428-83431450 GTGTTAAGTAACTTTCAGTATGG + Intergenic
1117287492 14:54301106-54301128 GTGTGAGGTACAGTGGAGGAGGG + Intergenic
1117682534 14:58219687-58219709 GTTTTAGGTTCAGTTCCGGAAGG + Exonic
1120868247 14:89314065-89314087 CTTTTAAGTATAGTTCAGTAGGG - Intronic
1125135456 15:36336031-36336053 GTGTTTGCTACAGTTTAGGAGGG - Intergenic
1128383785 15:67132730-67132752 GTATTCAGTACAGTTAAGCAAGG - Intronic
1131308826 15:91269362-91269384 TTGCTAAGTACAGTTCAGGAAGG - Intronic
1131751618 15:95514963-95514985 TTGTTAAGTACATTTAAAGAAGG + Intergenic
1132144634 15:99421729-99421751 GTGATAAGCACAGTTCAGACAGG + Intergenic
1132889916 16:2198682-2198704 GTGTTAAGCACAGGTCAGGGTGG - Intergenic
1140004285 16:71060135-71060157 GGCTTAGGTACAGTTCAGTAGGG + Intronic
1140237396 16:73171843-73171865 GTGTTGGGAACAGTTGAGGAGGG - Intergenic
1144803460 17:17948277-17948299 GTGTCAAGTACAGCTGGGGAGGG + Intronic
1147815970 17:43211227-43211249 GTGTTGAGTACAGTTGGTGAAGG + Exonic
1148963520 17:51413812-51413834 GAGTTAAACACAGATCAGGAAGG + Intergenic
1150463334 17:65371198-65371220 GTCTTTAGCCCAGTTCAGGAAGG - Intergenic
1151053322 17:71004234-71004256 GTGTTACCTGCAGTTCATGATGG - Intergenic
1151369451 17:73638688-73638710 GTGTCCATTACAGTCCAGGAGGG - Intronic
1152790877 17:82278887-82278909 CTGATAAGCACAGTTAAGGAAGG + Intergenic
1153151756 18:2103967-2103989 GTTTTAAGCACAATTCAGCAAGG + Intergenic
1154981330 18:21504799-21504821 GGGTTAAGTACAGTGCCTGAAGG + Intronic
1155231075 18:23775741-23775763 TTGTTAAGTGCAGTGAAGGACGG + Intronic
1155978927 18:32160758-32160780 GTGCCCAGAACAGTTCAGGAGGG + Intronic
1156217188 18:35011603-35011625 GTGTAAAGGAAAGATCAGGAAGG + Intronic
1156394592 18:36687621-36687643 GAGCTGAGTACAGTTCAGTAGGG - Intronic
1156615577 18:38780352-38780374 GTTTTAAGTACATTTAAGGTAGG - Intergenic
1158491601 18:57915216-57915238 TTGTAAGGTACAGTCCAGGAAGG - Intergenic
1162260867 19:9532856-9532878 GAGTCAAGGACAGTTCAGGGAGG - Exonic
1162606039 19:11708813-11708835 GTGTTCAGTGCAGTACAGAAGGG - Intergenic
1164694823 19:30235330-30235352 GTGCTAAGGACAGTTTAGGGAGG - Intronic
1168511652 19:56978361-56978383 GTGAGAAGCACAGTGCAGGAAGG - Intergenic
928014442 2:27642140-27642162 GTGTTGAGTTCAGTCCAGGGTGG - Intronic
931908877 2:66872498-66872520 GTGCTCAGTGCAGTTCAGCAGGG - Intergenic
932925100 2:75964320-75964342 GTCTTAAGTGCAGTTTAAGAAGG - Intergenic
938095251 2:128457226-128457248 GTGTGAAGCACAGGTCAGGAGGG - Intergenic
942554627 2:177158832-177158854 GTGTTATGTGAAATTCAGGAAGG + Intergenic
948198458 2:236112520-236112542 GAGTGAAGAACAGATCAGGAGGG - Intronic
1168989470 20:2081723-2081745 GTGTTAAGTATATTCAAGGAGGG - Intergenic
1178233454 21:30813881-30813903 ATGTTAGGTATAGTTTAGGAGGG - Intergenic
1182761151 22:32723344-32723366 GTGCTTAGAACAGTGCAGGAAGG + Intronic
1184834446 22:47012870-47012892 GTGCTAAGTACAGGCCTGGAAGG - Intronic
950159476 3:10749144-10749166 GTGTGAAGTACAGCTCAGCTTGG + Intergenic
951879966 3:27471306-27471328 TTGTTAAATAAAATTCAGGAAGG - Intronic
952861397 3:37815625-37815647 GTGAAAAGTCCAGTTCAGCAAGG + Intronic
955879186 3:63525652-63525674 GTGCTAGGCACAGTTCAAGAGGG + Intronic
956898298 3:73686324-73686346 GTGCTAGGCACAGTTCATGAAGG - Intergenic
959747412 3:109792880-109792902 GTGTTCAGAGCAGATCAGGATGG - Intergenic
962526995 3:136245992-136246014 GTTTTAAGGAAAGTTCAGCAAGG - Intergenic
962967765 3:140370330-140370352 GATTGAAGTACAGTCCAGGATGG + Intronic
964551895 3:157894040-157894062 TTGTTAACCACAGTACAGGAGGG - Intergenic
967807493 3:193728710-193728732 GTGTTATGTACAGTCCAGGATGG + Intergenic
968231052 3:197004761-197004783 GTGTTAAGTACTGATCAAGGAGG + Intronic
969101212 4:4769515-4769537 GAGCTAAGTACAGGGCAGGATGG + Intergenic
969229906 4:5822788-5822810 GTGATAAGTTGAGTACAGGAAGG - Intronic
973913944 4:55613812-55613834 GTGTTACTTACAGTCCAGCAGGG - Intronic
974394282 4:61314769-61314791 CTAGTGAGTACAGTTCAGGAAGG + Intronic
975573611 4:75841557-75841579 CTTTTGAGTACAGTTAAGGATGG + Intergenic
977556681 4:98494251-98494273 GGCTTAAGTACAGTTCAGGATGG - Intronic
978334376 4:107649664-107649686 GTTTTAAGTAAAGTTGAGGATGG - Intronic
978339744 4:107709709-107709731 GTGTTAAGTACACTTCTGGTTGG - Intronic
979096277 4:116554648-116554670 GTGTTAATTACAGTACTAGAAGG + Intergenic
979844066 4:125485964-125485986 GTGTTAAGTACAGTACTGCCAGG + Intronic
980674711 4:136061492-136061514 GTGTTAAGTACAGAGGAAGATGG + Intergenic
982762216 4:159298835-159298857 GTGTTAAGTACAGATCATCACGG - Intronic
983455747 4:167961918-167961940 GTGTTTGGTACAATTCAGTAGGG - Intergenic
986684298 5:10262311-10262333 TTGTTAACTACATTGCAGGAAGG + Intronic
987236585 5:15948635-15948657 GTGTGGAGTACTGTTCAGAAAGG + Intergenic
987555252 5:19437999-19438021 GTGATCAGTCCATTTCAGGATGG - Intergenic
988838063 5:35053312-35053334 ATGTTAATTAGAGTTCAGTAAGG + Intronic
991598423 5:68328116-68328138 TTGTTAAGAGCATTTCAGGAAGG - Intergenic
993792939 5:92229901-92229923 TTGCTAAGGACATTTCAGGAGGG - Intergenic
993802940 5:92366620-92366642 TTGTAAAGTACTGTTAAGGATGG + Intergenic
995607083 5:113868650-113868672 GTGTAAAGAACAGTCCAGGTAGG + Intergenic
996137561 5:119863234-119863256 GTGTTAGGTATTTTTCAGGAGGG + Intergenic
1004161103 6:13213671-13213693 GTGTGAAGTCCAGTTCACAAGGG - Intronic
1005147954 6:22713592-22713614 GTCTTATGTACAGTTCAGTTTGG + Intergenic
1008437676 6:51495453-51495475 ACAGTAAGTACAGTTCAGGAGGG + Intergenic
1014636437 6:123852804-123852826 GTTTATAGTAAAGTTCAGGAAGG - Intronic
1014880908 6:126723316-126723338 TTGTTAAGTACAGTCAAGGAAGG - Intergenic
1017450864 6:154553166-154553188 GTAGGAAGTACAGTTCTGGAAGG + Intergenic
1017917239 6:158840922-158840944 GTGCTAAGTCCACTTCAGGGTGG + Intergenic
1020426549 7:8072711-8072733 TTATTAAGTACAGTTCAGGTTGG + Intronic
1020500075 7:8907028-8907050 TTTTGAAGTACAGTTCAGAAAGG + Intergenic
1020997192 7:15279441-15279463 GTGTTCATTCCAGTTCAAGATGG - Intronic
1021503825 7:21358649-21358671 GTTTTAAGTACAGTTGAGTATGG - Intergenic
1028541547 7:91947832-91947854 GTGTTAAGTTCACTTAAAGATGG - Intronic
1031211463 7:118833555-118833577 GTGTTCAGTACTGTACTGGAGGG + Intergenic
1032188055 7:129744596-129744618 ATGCTAAGTACAGTTCAGATAGG + Intronic
1037069313 8:14623871-14623893 GTATTGAGTACAGTCCAGGTGGG - Intronic
1038254156 8:25935218-25935240 GTGCCAAATACAGTTAAGGATGG + Intronic
1043019721 8:74984985-74985007 TTTTTAAGTACAGTTTAAGAAGG - Intronic
1045622504 8:103997244-103997266 GGATTAAGTGCAGTTGAGGAAGG + Intronic
1047226816 8:122961991-122962013 GTGTTAATTGCATCTCAGGAGGG + Intronic
1048178742 8:132176295-132176317 GTGTTAAGTAATAGTCAGGATGG + Intronic
1048924534 8:139259686-139259708 GTGTTATGTACTTTTAAGGACGG - Intergenic
1051174587 9:14349252-14349274 GTGGGAAGGACAGTTCAGGCTGG + Intronic
1052636427 9:31111978-31112000 TTTTAAAATACAGTTCAGGAAGG + Intergenic
1053381013 9:37650172-37650194 GTGTTCAGTAGAGTTCAGCACGG + Intronic
1058650202 9:107168481-107168503 GGTTTAAGTACAGTCTAGGATGG - Intergenic
1060187928 9:121575189-121575211 GTGTTAAGTACAGTTCAGGAGGG - Intronic
1061653971 9:132073656-132073678 CTAATAAGAACAGTTCAGGAGGG + Intronic
1061884359 9:133584108-133584130 GTGTGTATTAAAGTTCAGGAAGG - Intronic
1189420740 X:40855598-40855620 GTGTTAAATGTAGTTTAGGATGG + Intergenic
1195814693 X:108872143-108872165 GTGTTGAGCACACTTCAGAATGG - Intergenic