ID: 1060187928

View in Genome Browser
Species Human (GRCh38)
Location 9:121575189-121575211
Sequence GTGTTAAGTACAGTTCAGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1060187928_1060187933 -10 Left 1060187928 9:121575189-121575211 CCCTCCTGAACTGTACTTAACAC No data
Right 1060187933 9:121575202-121575224 TACTTAACACCCCCAGGCCTGGG No data
1060187928_1060187940 29 Left 1060187928 9:121575189-121575211 CCCTCCTGAACTGTACTTAACAC No data
Right 1060187940 9:121575241-121575263 CTCCGTGTGACCTGTGAGCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1060187928 Original CRISPR GTGTTAAGTACAGTTCAGGA GGG (reversed) Intronic