ID: 1060187929

View in Genome Browser
Species Human (GRCh38)
Location 9:121575190-121575212
Sequence GGTGTTAAGTACAGTTCAGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1060187929_1060187940 28 Left 1060187929 9:121575190-121575212 CCTCCTGAACTGTACTTAACACC No data
Right 1060187940 9:121575241-121575263 CTCCGTGTGACCTGTGAGCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1060187929 Original CRISPR GGTGTTAAGTACAGTTCAGG AGG (reversed) Intronic