ID: 1060187929

View in Genome Browser
Species Human (GRCh38)
Location 9:121575190-121575212
Sequence GGTGTTAAGTACAGTTCAGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 99
Summary {0: 1, 1: 0, 2: 1, 3: 8, 4: 89}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1060187929_1060187940 28 Left 1060187929 9:121575190-121575212 CCTCCTGAACTGTACTTAACACC 0: 1
1: 0
2: 1
3: 8
4: 89
Right 1060187940 9:121575241-121575263 CTCCGTGTGACCTGTGAGCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1060187929 Original CRISPR GGTGTTAAGTACAGTTCAGG AGG (reversed) Intronic
905104003 1:35551819-35551841 GGTGTTAGGTGTAGTTCTGGTGG - Intronic
908028238 1:59972951-59972973 GGTGTTAAGCACAGTGGAAGAGG - Intergenic
914329280 1:146650799-146650821 GGGCTTAGGTACAGTTCAGTAGG - Intergenic
920123540 1:203676155-203676177 GGTGTTGGCTAAAGTTCAGGTGG - Intronic
921494951 1:215828114-215828136 GGGGTTAAGTATGGTTCAAGAGG - Intronic
922309413 1:224374066-224374088 GGTGTTACATATAGTTCAGAGGG + Intronic
923093224 1:230755090-230755112 GGTGCTGAGTGCAGCTCAGGAGG + Intronic
923984361 1:239364224-239364246 GATGTCAAGTACTGTTCAGCAGG + Intergenic
1063757605 10:9032579-9032601 GGTCTTATGAACTGTTCAGGGGG - Intergenic
1069063791 10:63921606-63921628 GGTTTTAAGTCCAGTTAAAGAGG + Intergenic
1069174468 10:65273120-65273142 GGTGGTAAGTAAGGTTCAGTAGG - Intergenic
1069274760 10:66575964-66575986 GCTGTTAAGTAAAGTTCAGCTGG + Intronic
1076078449 10:127556300-127556322 GGATTCAAGTACAGTTCATGTGG - Intergenic
1076290683 10:129343326-129343348 GCTGTTGAGTACAGAGCAGGAGG - Intergenic
1079870710 11:25794628-25794650 GGTTTTAAGTGCAGGTCTGGAGG + Intergenic
1080282982 11:30580091-30580113 GGTTTCAAATACAGCTCAGGAGG - Intronic
1086162111 11:83733501-83733523 GGTGTTAAATAGTGCTCAGGTGG + Intronic
1086642313 11:89174928-89174950 GGATTTAAGGACAGTTAAGGTGG - Intergenic
1091927481 12:4367307-4367329 GGTGTTAAGTTCTCTTCTGGCGG + Intergenic
1095104947 12:38222045-38222067 GGTGTTAAGATCACTCCAGGTGG + Intergenic
1095508599 12:42924993-42925015 GGTGTGAAGGACAATACAGGTGG + Intergenic
1098423406 12:70329725-70329747 ATTGTTAAGTACAGTACAAGTGG + Intronic
1101828249 12:108237461-108237483 GGTGTTAAGGACAGTGGAGAGGG + Intronic
1104200613 12:126584866-126584888 TTTGTTAAGTGCAGATCAGGAGG + Intergenic
1104782060 12:131428334-131428356 GGTGTTAGGAACAGTCCTGGTGG + Intergenic
1104971454 12:132532700-132532722 GGTGTTAAGCGCAGTGCAGGAGG + Intronic
1111634424 13:90885193-90885215 TATTTTAAGTACAGTTCTGGAGG - Intergenic
1120318469 14:82928517-82928539 GTAGTTACTTACAGTTCAGGTGG + Intergenic
1124532983 15:30522606-30522628 TGTGTCAAGTAGAGTGCAGGCGG + Intergenic
1125901584 15:43353136-43353158 TGTGTTAAGTAGAGTTCATTGGG + Exonic
1127848321 15:62891064-62891086 GGCTTTATGTACAGTTCAGAGGG + Intergenic
1128111808 15:65081188-65081210 GGTGTTCAGCACTGGTCAGGAGG - Intergenic
1128404016 15:67316619-67316641 GGTGTTAAGTACACTTTACATGG + Intronic
1132265226 15:100464375-100464397 GGTGTTACGAACAGTACAAGGGG - Intronic
1135969266 16:27060556-27060578 GGTGTTAAGCACAGTTCCAAAGG + Intergenic
1140004284 16:71060134-71060156 GGGCTTAGGTACAGTTCAGTAGG + Intronic
1143811075 17:9472352-9472374 GGTTTTAAGTACATTTTAGTGGG + Intronic
1149098809 17:52878462-52878484 AGTGTGAAGTACAGTTAAAGTGG + Intronic
1155076663 18:22363224-22363246 ATTGTTAAGAACAGTTTAGGTGG - Intergenic
1155978926 18:32160757-32160779 GGTGCCCAGAACAGTTCAGGAGG + Intronic
1156394593 18:36687622-36687644 GGAGCTGAGTACAGTTCAGTAGG - Intronic
1157941339 18:51932151-51932173 GGTTTTAAGTAGCGATCAGGTGG + Intergenic
1160309785 18:77778612-77778634 GGTGGCATGTGCAGTTCAGGGGG + Intergenic
1162563879 19:11434574-11434596 AGTATGAAGTACAGTTCAGTCGG + Intronic
1166393155 19:42421341-42421363 GGCGTTAAGTGCTGTGCAGGGGG - Intronic
927568353 2:24135578-24135600 GGTGTTTAGTACACTTCACATGG - Intronic
928832978 2:35511178-35511200 GATCTTAAATACAGTTCTGGAGG - Intergenic
932866608 2:75349799-75349821 GGTGTTCAGCTCAGTTCAGATGG - Intergenic
936815869 2:116459800-116459822 GGTGTTATGTACAGTTCTCTTGG + Intergenic
938095252 2:128457227-128457249 AGTGTGAAGCACAGGTCAGGAGG - Intergenic
938284856 2:130103529-130103551 GGAATAATGTACAGTTCAGGTGG - Intronic
946009734 2:216555010-216555032 GTTGTTAAGGACAGAACAGGTGG + Intronic
1173202020 20:40961327-40961349 GGTGTTGAGCCCAGTTGAGGTGG - Intergenic
1174983224 20:55420899-55420921 GGTGTTCAGTACAGATCTGTTGG + Intergenic
1176818137 21:13627013-13627035 GGAATAATGTACAGTTCAGGTGG + Intronic
1177217615 21:18150450-18150472 GGTTTGCAGTACAGTTCCGGAGG + Intronic
1178233455 21:30813882-30813904 GATGTTAGGTATAGTTTAGGAGG - Intergenic
950721995 3:14890115-14890137 GGGGTGGAGTACGGTTCAGGCGG - Intronic
955629551 3:60957888-60957910 GGTGTTAAGAACAGAGAAGGAGG - Intronic
956983294 3:74666150-74666172 AGTGTTAAATACAGATCTGGGGG - Intergenic
957545802 3:81635000-81635022 TGTGTTAAGAACAGTGAAGGAGG - Intronic
960322848 3:116258162-116258184 GGTGTTAAATTTAGTTTAGGAGG - Intronic
969228496 4:5814309-5814331 GGTCTCAAGTACAGGTCAGAGGG - Intronic
971424455 4:26502414-26502436 GGTCTTCAGTACAATTGAGGAGG + Intergenic
975583867 4:75930958-75930980 GGTGGTTAGTACAGGTCAGAGGG - Intronic
976782238 4:88773841-88773863 TGTGTTAAGTATAGTGCATGGGG - Intronic
976870766 4:89790814-89790836 GGGGTTAAGAACATTTCAGCGGG - Intronic
978402012 4:108341154-108341176 GGGGGTAGGTACAGATCAGGAGG + Intergenic
979785046 4:124706190-124706212 TGTGTTAGGTAGAGTTCAGCTGG - Intronic
980600272 4:135015057-135015079 GGTGTTAAGTACCTAACAGGTGG + Intergenic
982570586 4:157045950-157045972 TGTGTTAAGTAAAGATAAGGGGG + Intergenic
983400608 4:167260521-167260543 GTATTTAAGTTCAGTTCAGGTGG - Intergenic
983682401 4:170368917-170368939 GGTGATAAGTACAGTTCAGAAGG + Intergenic
986181719 5:5399364-5399386 GGTGTGACCTACAGTTCTGGAGG + Intergenic
987373037 5:17210524-17210546 GGTGTTAAAAAGAGTCCAGGGGG + Intronic
987685655 5:21197462-21197484 GGGTTTAGGTACAGTTGAGGTGG - Intergenic
987974743 5:24998954-24998976 GGTGTGAAATACAGATCAGAAGG + Intergenic
990047651 5:51454134-51454156 GGTGTTTAGCACAGTTGAGGTGG - Intergenic
992673429 5:79081910-79081932 GGTTTTCAGTAGAGTTCAGTGGG - Intronic
995997386 5:118318427-118318449 GGTGTTAAGATCAGTTATGGAGG + Intergenic
999404629 5:151296190-151296212 GGTGTTGAGCACAGTTCAACAGG + Exonic
1002213044 5:177609625-177609647 GATGTTGAGGACAGTGCAGGGGG - Exonic
1004606780 6:17202305-17202327 GGTGTTAATCACATTTCATGAGG - Intergenic
1021231245 7:18087655-18087677 GGTTTTAAGAAAAGTTCAGGAGG + Intronic
1022264513 7:28741077-28741099 GGAATTGAGCACAGTTCAGGAGG + Intronic
1024483330 7:49888503-49888525 GGGGTTAAGACCAGTTCAGAAGG + Intronic
1025799015 7:64766794-64766816 AGTGTTAAGTGCAGTTCAGAGGG - Intergenic
1037069314 8:14623872-14623894 GGTATTGAGTACAGTCCAGGTGG - Intronic
1042624932 8:70747602-70747624 TGTGTTTCTTACAGTTCAGGAGG - Intronic
1043483883 8:80679744-80679766 GGTGTTAAATAAAGTACACGTGG - Intronic
1044004183 8:86921926-86921948 GGTGGTAAGTGCAGTGTAGGGGG + Intronic
1046090310 8:109495797-109495819 GGTATTAAGTACAATTTAGGAGG + Intronic
1047226815 8:122961990-122962012 GGTGTTAATTGCATCTCAGGAGG + Intronic
1048028702 8:130610933-130610955 GGTGGTAAGTTCAGTTCAAGGGG - Intergenic
1060187929 9:121575190-121575212 GGTGTTAAGTACAGTTCAGGAGG - Intronic
1203529222 Un_GL000213v1:122491-122513 GGAATAATGTACAGTTCAGGTGG - Intergenic
1196121116 X:112051687-112051709 AGTGTTAAGTACATTTCACATGG + Intronic
1197844022 X:130781545-130781567 TGAGTTAACTGCAGTTCAGGAGG + Intronic
1201622178 Y:15972303-15972325 GATGTTGAATACATTTCAGGAGG + Intergenic