ID: 1060187930

View in Genome Browser
Species Human (GRCh38)
Location 9:121575193-121575215
Sequence GGGGGTGTTAAGTACAGTTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 66
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 62}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1060187930_1060187940 25 Left 1060187930 9:121575193-121575215 CCTGAACTGTACTTAACACCCCC 0: 1
1: 0
2: 0
3: 3
4: 62
Right 1060187940 9:121575241-121575263 CTCCGTGTGACCTGTGAGCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1060187930 Original CRISPR GGGGGTGTTAAGTACAGTTC AGG (reversed) Intronic
903015912 1:20361775-20361797 GGGGGTGGTTAGTTCAGTTCGGG - Intergenic
905104004 1:35551822-35551844 GGTGGTGTTAGGTGTAGTTCTGG - Intronic
907820897 1:57967370-57967392 GTGGGTAGCAAGTACAGTTCAGG - Intronic
913011747 1:114690165-114690187 GGAGGTGTTAAGTGCAGAGCAGG - Intronic
914317280 1:146525349-146525371 GGGGGTGTTTTGTTCAATTCTGG - Intergenic
914497076 1:148208011-148208033 GGGGGTGTTTTGTTCAATTCTGG + Intergenic
924027586 1:239851582-239851604 GTGGGTGTTTAATACATTTCAGG - Intronic
1067667094 10:48288019-48288041 GGGGCTGTTAAGTAAAGCCCAGG - Intergenic
1069017006 10:63441603-63441625 GAGGGCGTTAAGTAAAGTTGAGG - Intronic
1073554015 10:104430110-104430132 GGGGGTTTTAAGTACTGATGTGG + Intronic
1074327966 10:112471269-112471291 GAGGGTGTTAAGGAAAGTTAGGG + Intronic
1089789101 11:120929664-120929686 AGGGGTGTTAATTACAGCCCGGG - Intronic
1091762702 12:3097622-3097644 AGGGGTGGCAAGTACAGTGCTGG + Intronic
1096776140 12:53965505-53965527 GGGGCTGTGAAGGCCAGTTCAGG + Intergenic
1098708462 12:73722378-73722400 GTTGGTGTATAGTACAGTTCTGG - Intergenic
1099842891 12:87988799-87988821 GTGGATTTTAAGTACAGTTAAGG + Intronic
1099927632 12:89037677-89037699 GGGGATGTTGAGTTCAGTTTGGG - Intergenic
1100307308 12:93362564-93362586 AGGGATGTTGAGTTCAGTTCAGG - Intergenic
1104971453 12:132532697-132532719 CGGGGTGTTAAGCGCAGTGCAGG + Intronic
1106393078 13:29354678-29354700 GCTGGTCTTAAGTACAGGTCGGG - Intronic
1110576837 13:77067231-77067253 GGGGGAATAAAGTAAAGTTCAGG - Intronic
1114963520 14:27926108-27926130 GGAGGTGGTGAGTACAGTTTGGG + Intergenic
1119617459 14:76108109-76108131 GGAAGTGTTAAGTAGAGTCCCGG - Intergenic
1122305280 14:100761919-100761941 GGGGGTATTGAGTGCAGTTTTGG - Intergenic
1122762142 14:104037166-104037188 GGGGGTCTTCAGTACAGAACTGG + Intronic
1131308827 15:91269366-91269388 GAGCTTGCTAAGTACAGTTCAGG - Intronic
1132804353 16:1768843-1768865 GGGGGTCCTATGTACAGGTCGGG - Exonic
1133808691 16:9144820-9144842 CTGGGTGTTAGGGACAGTTCAGG + Intergenic
1134247002 16:12547546-12547568 GGGGATGTTAACCACAGCTCAGG - Intronic
1134605722 16:15569667-15569689 AGGGGTGCTAAGTCCACTTCTGG + Intronic
1146612462 17:34319801-34319823 GTGGGTGTAAAGGACATTTCAGG + Intronic
1148246152 17:46032132-46032154 AGGGGTGCTGAGTGCAGTTCCGG + Exonic
1151421506 17:74001038-74001060 GGGGGTGACCAGAACAGTTCTGG - Intergenic
1166874977 19:45891421-45891443 GGGGGTGAGAAGGATAGTTCTGG - Intronic
925139066 2:1537561-1537583 GGGGGTGTTGAACACAGTTGGGG - Intronic
928832979 2:35511181-35511203 GGGGATCTTAAATACAGTTCTGG - Intergenic
929139698 2:38656085-38656107 GGGGGTGTCAGATACACTTCAGG - Intergenic
931793605 2:65688675-65688697 GGGGGTGTTAAATCAACTTCAGG - Intergenic
934568247 2:95352500-95352522 GGGGCTGCTAAGTCCAGTGCTGG - Intronic
935364202 2:102272046-102272068 GGCGGTGGTAAGTACAGTAATGG - Intergenic
944647233 2:201792077-201792099 TAAGGTGTTAAGTAGAGTTCAGG + Intronic
946539146 2:220664654-220664676 GGGGGCGTTAAATACATGTCAGG - Intergenic
1180856965 22:19053541-19053563 GGAGGTCTTTAGTACAGTGCAGG - Intronic
957803313 3:85114495-85114517 GGGCATGTTAATTACTGTTCAGG - Intronic
962105781 3:132387469-132387491 AGGGGTATTATCTACAGTTCAGG + Intergenic
967240763 3:187437127-187437149 GTGGGTGTTGAGGACGGTTCAGG + Intergenic
974191719 4:58513023-58513045 TGCGGTGTTAAGTCCATTTCAGG + Intergenic
978334219 4:107648483-107648505 TGGGATGTGAAGCACAGTTCTGG - Intronic
978339745 4:107709713-107709735 TAGTGTGTTAAGTACACTTCTGG - Intronic
991949571 5:71934134-71934156 GGGGGTGTTTAGTCCAGACCTGG + Intergenic
996776905 5:127142741-127142763 GGGGGCCTTAAGTAAAGATCCGG - Intergenic
997524547 5:134543970-134543992 GGAGGTGTGAAGGACAGTTCTGG + Intronic
1001439176 5:171725697-171725719 GGGGGTGGTAAGTGTAGTTGGGG - Intergenic
1005475619 6:26204768-26204790 GGGGGTGTCAAGCGCATTTCTGG + Exonic
1016362649 6:143285084-143285106 GGGGGGATTAAGTACAATTGAGG - Intronic
1032090943 7:128911345-128911367 AGGGGTGTTGAGTGGAGTTCAGG - Intergenic
1034095008 7:148399626-148399648 GGGGGAGTTTATTACAGTTTAGG - Intronic
1036398021 8:8385511-8385533 GGAGTTGTTAAGAATAGTTCAGG + Intronic
1037069315 8:14623875-14623897 GTGGGTATTGAGTACAGTCCAGG - Intronic
1042377177 8:68065031-68065053 GGGTGTATAAACTACAGTTCGGG - Intronic
1043066227 8:75574265-75574287 GGGGTTGTGAAGTACATTTTTGG + Intergenic
1047178370 8:122563867-122563889 GTGGGTGTTAAGTACTCCTCAGG - Intergenic
1060187930 9:121575193-121575215 GGGGGTGTTAAGTACAGTTCAGG - Intronic
1062381659 9:136289891-136289913 GGGGGGGCCAAGAACAGTTCTGG - Intronic
1196751413 X:119121008-119121030 GGGGGTGTTGGATACAGTTAGGG - Intronic
1196844653 X:119888538-119888560 GGGGGTAAGAAGTAAAGTTCTGG + Intergenic