ID: 1060187930 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 9:121575193-121575215 |
Sequence | GGGGGTGTTAAGTACAGTTC AGG (reversed) |
Strand | - |
Crispr in exon? | No |
Crispr in intron? | Yes |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | ||||
Summary |
Found 1 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1060187930_1060187940 | 25 | Left | 1060187930 | 9:121575193-121575215 | CCTGAACTGTACTTAACACCCCC | No data | ||
Right | 1060187940 | 9:121575241-121575263 | CTCCGTGTGACCTGTGAGCCAGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1060187930 | Original CRISPR | GGGGGTGTTAAGTACAGTTC AGG (reversed) | Intronic | ||