ID: 1060187933

View in Genome Browser
Species Human (GRCh38)
Location 9:121575202-121575224
Sequence TACTTAACACCCCCAGGCCT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1060187927_1060187933 -9 Left 1060187927 9:121575188-121575210 CCCCTCCTGAACTGTACTTAACA No data
Right 1060187933 9:121575202-121575224 TACTTAACACCCCCAGGCCTGGG No data
1060187928_1060187933 -10 Left 1060187928 9:121575189-121575211 CCCTCCTGAACTGTACTTAACAC No data
Right 1060187933 9:121575202-121575224 TACTTAACACCCCCAGGCCTGGG No data
1060187924_1060187933 10 Left 1060187924 9:121575169-121575191 CCCATAGGCTCCTGGAGAGCCCC No data
Right 1060187933 9:121575202-121575224 TACTTAACACCCCCAGGCCTGGG No data
1060187926_1060187933 0 Left 1060187926 9:121575179-121575201 CCTGGAGAGCCCCTCCTGAACTG No data
Right 1060187933 9:121575202-121575224 TACTTAACACCCCCAGGCCTGGG No data
1060187925_1060187933 9 Left 1060187925 9:121575170-121575192 CCATAGGCTCCTGGAGAGCCCCT No data
Right 1060187933 9:121575202-121575224 TACTTAACACCCCCAGGCCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1060187933 Original CRISPR TACTTAACACCCCCAGGCCT GGG Intronic