ID: 1060187934

View in Genome Browser
Species Human (GRCh38)
Location 9:121575211-121575233
Sequence AGATAGAAGCCCAGGCCTGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 991
Summary {0: 1, 1: 0, 2: 7, 3: 89, 4: 894}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1060187934_1060187940 7 Left 1060187934 9:121575211-121575233 CCCCCAGGCCTGGGCTTCTATCT 0: 1
1: 0
2: 7
3: 89
4: 894
Right 1060187940 9:121575241-121575263 CTCCGTGTGACCTGTGAGCCAGG No data
1060187934_1060187945 30 Left 1060187934 9:121575211-121575233 CCCCCAGGCCTGGGCTTCTATCT 0: 1
1: 0
2: 7
3: 89
4: 894
Right 1060187945 9:121575264-121575286 CCAGTTGATTCTCAGAGCCTCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1060187934 Original CRISPR AGATAGAAGCCCAGGCCTGG GGG (reversed) Intronic
900032417 1:381153-381175 GGGGAGATGCCCAGGCCTGGCGG + Intergenic
900052967 1:609339-609361 GGGGAGATGCCCAGGCCTGGCGG + Intergenic
900053285 1:610691-610713 GGGGAGATGCCCAGGCCTGGCGG + Intergenic
900367077 1:2315686-2315708 AGATAGGAGGCCAGGCCTGCAGG - Intergenic
900377913 1:2367330-2367352 AGAAAAAAGGCCAGGCTTGGTGG + Intronic
900694937 1:4004009-4004031 TGATAGCAGGCCAGGCCAGGAGG + Intergenic
900729100 1:4240377-4240399 AGATGGAAGAGCAGACCTGGTGG + Intergenic
900898174 1:5498358-5498380 AGAAAGGAGCACAGCCCTGGAGG - Intergenic
901430985 1:9214796-9214818 AAAAAGAAGGCCAGGCATGGTGG + Intergenic
901490233 1:9592935-9592957 AGAGAGGAGCTCGGGCCTGGAGG - Intronic
901618355 1:10560342-10560364 AGATGGAAGGCCGGGCATGGTGG - Intronic
901689589 1:10964068-10964090 AGAGAGAAGCCCAGCCTGGGAGG + Intronic
901841744 1:11958060-11958082 GGATAGAACCCCAGGCAGGGAGG - Intronic
903051988 1:20608195-20608217 AGTTAGAAGCCCAGGCTTCAGGG + Intronic
903183778 1:21618407-21618429 CCCTAGAAGACCAGGCCTGGTGG - Intronic
903371180 1:22837206-22837228 AGAAAGCAGCTCAGGCCTGAAGG + Intronic
903753297 1:25643556-25643578 ATATAAAAGGCCAGGCGTGGTGG - Intronic
904161382 1:28524568-28524590 AAATAAAAGGCCAGGCATGGTGG + Intronic
904302129 1:29561261-29561283 AGCTACAGGCTCAGGCCTGGGGG - Intergenic
904506007 1:30954773-30954795 ATATAGCAGGCCAGGCGTGGTGG + Intronic
904553376 1:31340233-31340255 AGAAAGAAGCCTGGGCATGGTGG - Intronic
904633623 1:31862206-31862228 AGATAAAAAGCCAGGCTTGGTGG + Intergenic
904840343 1:33368383-33368405 GGGTAGACGCGCAGGCCTGGGGG + Intronic
904936230 1:34131642-34131664 AGAGAGAGGCCTGGGCCTGGAGG - Intronic
905235726 1:36546085-36546107 ATATAGAAGGCCAGGCATGGTGG - Intergenic
905398569 1:37684869-37684891 TGAGAGAAGACCAGGCATGGTGG + Intronic
906022276 1:42640604-42640626 AGATGGATGGCCAGGCATGGTGG + Intronic
906449963 1:45937028-45937050 AAAAAAAAGCCCAGGCATGGTGG - Intronic
906628491 1:47345203-47345225 AGAATGAAGGCCAGGCGTGGTGG - Intronic
906668203 1:47636544-47636566 GGACAGGAGCCCAGGGCTGGGGG - Intergenic
906982180 1:50643115-50643137 AGAGAAAAGGCCAGGCGTGGTGG - Intronic
907131838 1:52104149-52104171 AGAAAGAAGGCCAGGCGCGGTGG - Intergenic
908686832 1:66730087-66730109 AAAAAGAAGGCCAGGCGTGGTGG - Intronic
909971780 1:81999687-81999709 AAATAGCAGGCCAGGCATGGTGG + Intergenic
910556012 1:88533855-88533877 GGATAGAAACCAAGTCCTGGTGG - Intergenic
910754485 1:90672829-90672851 AGATACCAACCCAGGCATGGTGG - Intergenic
910906812 1:92189802-92189824 AGAAAGAAGGCCAGACATGGTGG + Intergenic
911334509 1:96564849-96564871 AGATGGTAGGCCAGGCGTGGTGG - Intergenic
911423459 1:97676032-97676054 AGATGGTAGGCCAGGCGTGGTGG - Intronic
911605483 1:99899905-99899927 AGAAAGAAGGCCGGGCGTGGTGG - Intronic
911684638 1:100760846-100760868 TAATAGTAGCACAGGCCTGGAGG - Intergenic
912271564 1:108215653-108215675 AGAAATAAGGCCAGGCATGGTGG - Intergenic
912523103 1:110260005-110260027 AGATGCATGCCCAGGCCTGCTGG - Intronic
913363961 1:118014995-118015017 AGATAGAGGGCCGGGCGTGGTGG + Intronic
914451662 1:147798246-147798268 AGCTAGTAGGCCAGGGCTGGAGG - Intergenic
914700667 1:150129996-150130018 AGATAGATAGCCAGGCTTGGTGG - Intronic
914751940 1:150540606-150540628 AAAAAGAAGGCCAGGCGTGGTGG + Intergenic
914752072 1:150541510-150541532 AGAAAAAAGGCCAGGCGTGGTGG + Intergenic
915307244 1:154987647-154987669 AGAAAGCAGGCCAGGCGTGGTGG + Intronic
915444611 1:155967603-155967625 AGGGAGAAGGCCAGGCTTGGTGG - Intronic
916038515 1:160942549-160942571 AGATTTAAGGCCAGGCATGGTGG - Intergenic
916083053 1:161248270-161248292 ACATAGACGGCCAGGCATGGTGG - Intergenic
916242825 1:162657125-162657147 AGATTGGTGCCCAGGCATGGTGG - Intronic
916568928 1:166008314-166008336 GGGTGGAGGCCCAGGCCTGGAGG + Intergenic
917173315 1:172201798-172201820 GGCTGGAGGCCCAGGCCTGGAGG + Intronic
917889536 1:179421667-179421689 AGATAAAGGTCCAGGCATGGTGG - Intronic
919560685 1:199114863-199114885 AAAAAGAAGGCCAGGCATGGTGG + Intergenic
919577994 1:199336453-199336475 GGCTAGAGGCCCAGGCCTGGAGG + Intergenic
919619915 1:199852754-199852776 AATTAGAAGACCAGGCATGGTGG + Intergenic
919625777 1:199908851-199908873 AGAGAGAAAGCCAGGCGTGGTGG + Intergenic
919664978 1:200283081-200283103 AGAGAGAAGGCCAGGCACGGTGG + Intergenic
920778420 1:208964079-208964101 TGATAGTAGGCCAGGCATGGTGG - Intergenic
920786935 1:209050917-209050939 GGCTAGAGGCCCAGGCCTGGAGG - Intergenic
920893113 1:210012987-210013009 AGAAAAAAGGCCAGGCGTGGTGG - Intronic
921027348 1:211298717-211298739 AGAAAGAGGGCCAGGCGTGGTGG + Intronic
921587538 1:216965645-216965667 AGATACATTCCTAGGCCTGGGGG + Intronic
921944052 1:220874440-220874462 AGGGAGATGCCCGGGCCTGGTGG + Intergenic
921952001 1:220939814-220939836 TAATAGAAGCCCAGGGCTTGAGG + Intergenic
922435106 1:225597370-225597392 ACAAAGAAGGCCAGGCATGGTGG + Intronic
922552602 1:226507078-226507100 AGATAGAAGCCCAGCCTAGCAGG - Intergenic
922732373 1:227957077-227957099 AGAAATAAGTCCAGGCATGGTGG - Intergenic
923183953 1:231551346-231551368 ACATAAAAGCCCAGGTCTGATGG - Intronic
923665760 1:235997119-235997141 AGAGAGGAGGCCAGGCATGGTGG - Intronic
924042043 1:239993157-239993179 AGATACAGGGCCAGGCATGGTGG + Intergenic
924152098 1:241140045-241140067 AGAGAGAAGAGCAGGTCTGGAGG - Intronic
924233502 1:241981599-241981621 AGATAGAGGGCCAGGAATGGTGG + Intergenic
1062879339 10:965351-965373 AGAAACCAGCCCAGGCCTTGGGG - Intergenic
1062992418 10:1832837-1832859 ATTTAAAAGGCCAGGCCTGGTGG + Intergenic
1064102520 10:12475998-12476020 AGAGAGAAGTCTAGGCCGGGTGG + Intronic
1064202294 10:13295051-13295073 AGACTGAAGCCCAGGCATGGTGG + Intronic
1064202670 10:13298277-13298299 ATATAGAAGGCCAGGCACGGTGG + Intronic
1064280048 10:13943275-13943297 AGAAATAGACCCAGGCCTGGTGG + Intronic
1064280265 10:13945076-13945098 AGAAATAGACCCAGGCCTGGTGG + Intronic
1064535769 10:16356092-16356114 AGATAGTAGGCCAGGCATAGTGG - Intergenic
1064590408 10:16884267-16884289 AGATAGTAGGCCGGGCATGGTGG - Intronic
1064611007 10:17102572-17102594 AGTAACAAGGCCAGGCCTGGTGG - Intronic
1064657461 10:17570146-17570168 ATACAGAAGGCCAGGCGTGGTGG + Intergenic
1064884429 10:20093958-20093980 AGATAGTTGGCCAGGCATGGTGG - Intronic
1064898217 10:20262859-20262881 GGCTGGAGGCCCAGGCCTGGAGG - Intronic
1065912861 10:30324714-30324736 AGAAACAAGGCCAGGCGTGGCGG + Intronic
1066425391 10:35303488-35303510 GGAAAGAAGCCCAGGCATGGTGG + Intronic
1066427324 10:35319586-35319608 AGAAAGAAGGCCAGGCACGGTGG + Intronic
1067000971 10:42613256-42613278 AAATGGAAGGCCAGGCATGGTGG + Intronic
1067407341 10:46034851-46034873 TGATAGAAGCCCAGGCATGGTGG + Intronic
1067662465 10:48246699-48246721 AGAACGAGGCCCAGGACTGGGGG + Intronic
1068143776 10:53039548-53039570 AGAAATTAGCCCAGGCATGGTGG + Intergenic
1068862922 10:61866082-61866104 AGATAACAGGCCAGGCGTGGTGG - Intergenic
1069004234 10:63299016-63299038 AGAATGAAGGCCAGGCATGGTGG - Intronic
1069459072 10:68577332-68577354 AAATAGAAGGCCAGGCACGGTGG - Intronic
1069646303 10:70000752-70000774 AAATTGAAGGCCAGGCATGGTGG - Intergenic
1069666227 10:70162050-70162072 AGAAAGCAGGCCAGGCATGGTGG + Intronic
1069711266 10:70490208-70490230 AGAGAGAGGGCCAGGCGTGGTGG - Intronic
1069986683 10:72289169-72289191 ACATAAAAGGCCGGGCCTGGTGG + Intergenic
1070099369 10:73370265-73370287 AGATATAAGGCCAGGTGTGGTGG + Intergenic
1070172441 10:73942861-73942883 AGAAATAAGGCCAGGCGTGGTGG + Intergenic
1070258734 10:74832785-74832807 AGATACAAGGCCAGGCTTGGTGG - Intronic
1070536420 10:77381473-77381495 AGAAGGAAACCGAGGCCTGGAGG - Intronic
1070584101 10:77748065-77748087 GGATGGGAGCCCAGGCCTGTTGG - Intergenic
1070699832 10:78593650-78593672 AAAAAAAAGCCCAGGCATGGTGG - Intergenic
1071299136 10:84243461-84243483 AGACAGAAGGCCAGGCAGGGTGG + Intergenic
1071546527 10:86534250-86534272 AGCTAGAGGCTCAAGCCTGGAGG + Intergenic
1071606492 10:86996128-86996150 AGATAAAAGACCAGGCGCGGTGG - Intergenic
1072315274 10:94196496-94196518 AGAGAGAGGGCCAGGCATGGTGG + Intronic
1072647086 10:97265212-97265234 AAACAGAAGGCCAGGCATGGTGG + Intronic
1072666332 10:97395561-97395583 AAAAAGTAGACCAGGCCTGGTGG + Intronic
1073428783 10:103472489-103472511 AGACACAAGCCCGGGCATGGTGG + Intergenic
1073769825 10:106724219-106724241 AGATATAAGGCCGGGCATGGTGG + Intronic
1074691031 10:116004239-116004261 AGACAGAAGCCGAGCCCAGGGGG + Intergenic
1074936485 10:118187026-118187048 AACTAGAAGGCCAGGCATGGTGG + Intergenic
1074952001 10:118346116-118346138 AGATAGAGGGCCAGGCACGGTGG - Intergenic
1075015794 10:118909210-118909232 AGAGAGAAGGCCAAGTCTGGGGG + Intergenic
1075185758 10:120255434-120255456 AGATAATAGGCCAGGCGTGGTGG + Intergenic
1075365687 10:121886313-121886335 AGACAGTAGCCCTGGCCAGGAGG - Intronic
1075893849 10:125978008-125978030 GGCTGGAGGCCCAGGCCTGGAGG + Intronic
1076509053 10:130999372-130999394 AGCCAGAACCCAAGGCCTGGAGG + Intergenic
1076584349 10:131535085-131535107 GGACAGGATCCCAGGCCTGGAGG - Intergenic
1076977012 11:180920-180942 AGATAGCAGGCCAGGTGTGGTGG + Intronic
1076988227 11:254616-254638 AAATAGATGGCCAGGCGTGGTGG - Intergenic
1077485105 11:2834967-2834989 AGGTTGGAGGCCAGGCCTGGGGG - Intronic
1077915133 11:6606731-6606753 AGATAGAAGTCCAGGCCCTGAGG + Intronic
1078211352 11:9272388-9272410 AGAGAGCAGGCCAGGCATGGTGG + Intergenic
1078262273 11:9721101-9721123 AGATTGAACGCCAGGCGTGGTGG - Intronic
1078597734 11:12703003-12703025 GGATTCAAGCCCAGGCCTGCCGG + Intronic
1078823679 11:14906689-14906711 AGAGAGATGTCCAGGCCTGAGGG - Intronic
1078875374 11:15389494-15389516 AGAAAGCAGGCCAGGCGTGGTGG - Intergenic
1079008318 11:16808432-16808454 TGATAAAAGCACAGACCTGGAGG - Intronic
1079327265 11:19504993-19505015 AGACTGAAACCCAGGCCTGTTGG + Intronic
1079472909 11:20797163-20797185 GGATATAAGCACAGGCTTGGTGG + Intronic
1079950274 11:26793358-26793380 AGAAAGGAGCCCAGGCTTGAGGG + Intergenic
1080474141 11:32574046-32574068 GGATAGAAGGCTAGGCGTGGTGG - Intergenic
1080935978 11:36863966-36863988 TGATAGAAGACCAGACCAGGTGG - Intergenic
1081598371 11:44475032-44475054 AGGTAGAAGACCATGTCTGGAGG + Intergenic
1081687877 11:45055218-45055240 AGACTGGAGCCCAGGTCTGGAGG - Intergenic
1082079890 11:48004643-48004665 TGTTAGCAGCCCAGGCCTGCAGG + Intronic
1082173875 11:49039560-49039582 AAAAAGGAGCCCAGGCATGGTGG + Intergenic
1082806513 11:57455118-57455140 AAATAATAGGCCAGGCCTGGTGG + Intergenic
1083442128 11:62684018-62684040 AAAAAGAAGGCCAGGCATGGTGG - Intergenic
1083714604 11:64568263-64568285 TGGCAGAAGCCCTGGCCTGGAGG - Intronic
1083902676 11:65651209-65651231 AGAGAGAGGACAAGGCCTGGGGG - Intergenic
1084059935 11:66664884-66664906 GGATTTAAGCCCAGGCATGGTGG - Intronic
1084187133 11:67479591-67479613 AATTAGAAGGCCAGGCATGGTGG - Intergenic
1084897808 11:72287601-72287623 AGATTGATGGCCAGGCATGGTGG - Intergenic
1085260101 11:75199722-75199744 AAAGAGAAGCCCAGGCCTCTTGG + Intronic
1085398510 11:76220083-76220105 TGATAGAAGGCCTGGCCTTGTGG + Intergenic
1085568396 11:77537175-77537197 AGCTAAAAGGCCAGGCGTGGTGG + Intronic
1085880663 11:80463412-80463434 GGCAGGAAGCCCAGGCCTGGAGG - Intergenic
1086103982 11:83129508-83129530 AGATACACGGCCAGGCATGGTGG + Intergenic
1086691894 11:89796521-89796543 AAATAGGAGCCCAGGCATGGTGG - Intergenic
1086713906 11:90043135-90043157 AAATAGGAGCCCAGGCATGGTGG + Intergenic
1086946992 11:92853425-92853447 AGAGAAAAGCCCAGACCTAGGGG - Intronic
1087164231 11:94984566-94984588 AAATAGCAGGCCAGGCATGGTGG + Intronic
1087427275 11:98006437-98006459 AAATAGACGGCCAGGCGTGGTGG + Intergenic
1087820636 11:102707770-102707792 AGATGTAAGGCCAGGCATGGTGG - Intergenic
1088115022 11:106303659-106303681 GGATAGAGGCCCTGGACTGGGGG + Intergenic
1088602268 11:111491458-111491480 AAAGAGAAGGCCAGGCATGGTGG + Intronic
1088904921 11:114148050-114148072 AGCCAGAAGCCCAGGCCTCTTGG + Intronic
1088990603 11:114950245-114950267 TGAGAGAAGCCCAGGAATGGGGG + Intergenic
1089473905 11:118743004-118743026 GGCTAGAAGGCCGGGCCTGGTGG + Intergenic
1089522631 11:119075562-119075584 AAATACAAGGCCAGGCGTGGTGG + Intronic
1089740742 11:120580552-120580574 AGAAAGGAGGCCAGGCATGGTGG - Intronic
1090541924 11:127715896-127715918 AGATAGAAGGCTGGGCATGGTGG + Intergenic
1091074646 11:132604008-132604030 AGATAAAGGCCCTGACCTGGTGG - Intronic
1091130929 11:133146746-133146768 AGATAGAGGTCCCGGCGTGGTGG - Intronic
1091418342 12:311354-311376 AGTTAGCAGGCCAGGCGTGGTGG + Intronic
1091635499 12:2193740-2193762 ACATAGATGGCCAGCCCTGGAGG - Intronic
1091857399 12:3750929-3750951 AGATGGAACCCCAGGTGTGGGGG - Intronic
1092185773 12:6477596-6477618 ATACAGAAGGCCAGGCATGGTGG - Intergenic
1092245568 12:6862231-6862253 AGAAAAAAGCCCAGGCATGGTGG - Intronic
1092486835 12:8909310-8909332 AGAAAAAAGGCCAGGCGTGGTGG + Intergenic
1092587901 12:9919608-9919630 GGCTGGAGGCCCAGGCCTGGAGG + Intronic
1092965724 12:13640096-13640118 AGATACAAGACCAGGCATGGTGG + Intronic
1093451881 12:19325400-19325422 TAATAGAAGGCCAGGCATGGTGG + Intronic
1093482960 12:19624184-19624206 AGATAGAAGGCCAGAGGTGGAGG - Intronic
1093512390 12:19944775-19944797 AGATAACAGCTCAGGCCTGAGGG - Intergenic
1093931461 12:24958710-24958732 AGCTAGAAGGCCGGGCCTGGTGG - Intergenic
1093938635 12:25028210-25028232 AGAAACAAGGCCAGGCGTGGTGG - Intronic
1094144582 12:27215046-27215068 AGAGAGAAGGCCAGACATGGTGG - Intergenic
1094599518 12:31896286-31896308 AAATAAAAGACCAGGCCCGGTGG + Intergenic
1095163359 12:38941965-38941987 AGGGAGAGTCCCAGGCCTGGCGG + Intergenic
1095824325 12:46515999-46516021 GGCTGGAGGCCCAGGCCTGGAGG + Intergenic
1096223823 12:49851168-49851190 AGCTACAAGGCCAGGCGTGGTGG - Intergenic
1096275635 12:50205358-50205380 AAATACGAGCCCAGGCATGGTGG - Intronic
1096361708 12:50993536-50993558 AAATACAAGGCCAGGCATGGTGG + Intronic
1096579868 12:52577966-52577988 AGAAAGAAGGCCAGGCATGGTGG + Intergenic
1096645977 12:53036069-53036091 AAATAGAAGGCCAGGCATGGTGG - Intronic
1096708616 12:53439120-53439142 AAATAACAGGCCAGGCCTGGTGG + Intergenic
1097168999 12:57102119-57102141 AGGAAAAACCCCAGGCCTGGGGG - Intronic
1097218631 12:57433604-57433626 AGACAGCAGACCAGGCATGGCGG - Intergenic
1097806714 12:63972859-63972881 TGATAGAAGGCCAGGCATGGTGG + Intronic
1098280818 12:68861171-68861193 GGAAAGAAAGCCAGGCCTGGTGG - Intronic
1098724437 12:73944862-73944884 AGCCAGAAGACCAGGCATGGTGG - Intergenic
1099154601 12:79158608-79158630 TGATAAAAGGCCAGGCATGGTGG + Intronic
1099184733 12:79504547-79504569 GGCTGGAGGCCCAGGCCTGGAGG - Intergenic
1100389698 12:94137710-94137732 AGATACATGCCCAGGTGTGGTGG - Intergenic
1100608135 12:96168721-96168743 AGATACATGGCCAGGCGTGGTGG - Intergenic
1100836456 12:98571369-98571391 AAAAAAAAGGCCAGGCCTGGTGG - Intergenic
1101379114 12:104198692-104198714 AAAAAGAAGGCCAGGCGTGGGGG + Intergenic
1101950569 12:109171635-109171657 AAAGAGAAGGCCAGGCGTGGTGG - Intronic
1102272492 12:111549774-111549796 AGATACCTGCCCAGGCGTGGTGG + Intronic
1102818800 12:115890516-115890538 AAATAAAAGGCCAGGCATGGTGG + Intergenic
1102892333 12:116569766-116569788 AGATAACAGGCCAGGCATGGTGG + Intergenic
1103148519 12:118616645-118616667 AGAAATAAGGCCAGGCATGGTGG + Intergenic
1103265792 12:119629120-119629142 AGACAGAAGGCCGGGCGTGGTGG + Intronic
1103346353 12:120253183-120253205 AGAAAGAAGACCAGGCATAGTGG + Intronic
1103962951 12:124620898-124620920 AGATACAAGCCCAGGCGTGGTGG - Intergenic
1103973496 12:124687117-124687139 AGAGAGAACCTCAGGCCCGGAGG - Intergenic
1103998027 12:124842525-124842547 ACACAGATGCCCAGGCCTGCTGG + Intronic
1104067511 12:125317674-125317696 AGGTGAAAGCCCAGCCCTGGAGG - Intronic
1104390586 12:128388048-128388070 AAATAGAAGCCCTGGCCTCTTGG - Intronic
1105001156 12:132689637-132689659 AAATACAAACCAAGGCCTGGAGG + Intronic
1105558730 13:21470563-21470585 ACAAAGAAGGCCAGGCGTGGTGG - Intergenic
1105781780 13:23711884-23711906 AAAAAGAAGGCCAGGCATGGTGG + Intergenic
1106600277 13:31181524-31181546 AGAAAAAAGGCCAGGCGTGGTGG - Intergenic
1107252075 13:38375986-38376008 ATAGAGAAGACCAGGCATGGTGG - Intergenic
1107362060 13:39629662-39629684 AAATAGAAGGCCGGGCATGGTGG - Intergenic
1108684410 13:52806407-52806429 AAACTGAAGCCCAGGCATGGGGG + Intergenic
1108746280 13:53397888-53397910 GGACAGAAGCCCAAGCCTGGAGG + Intergenic
1109063455 13:57651623-57651645 AAATAGAATCCCAGGCATTGTGG - Intronic
1110279845 13:73680369-73680391 AAATATAAGGCCAGGCTTGGTGG - Intergenic
1110346540 13:74454406-74454428 AGAAATAAGGCCAGGCCTGGTGG + Intergenic
1110859656 13:80333911-80333933 AAATTGGAGCCCAGGCATGGTGG - Intergenic
1112014664 13:95321817-95321839 AAATATAAGGCCAGGCATGGTGG + Intergenic
1112394972 13:99021350-99021372 AGAGGGAAGGCCAGGCGTGGTGG + Intronic
1112705670 13:102066843-102066865 AGAGAGCAGCAGAGGCCTGGAGG - Intronic
1113150858 13:107262125-107262147 ATATGGAAGGCCAGGCATGGTGG + Intronic
1113679011 13:112229372-112229394 AGGCAGAAGCCCAGGCCTGGTGG - Intergenic
1114227978 14:20756090-20756112 AGAAAGAAGGCTGGGCCTGGGGG - Intergenic
1114294044 14:21313500-21313522 AGATAGATGGCCAGGCGCGGCGG + Intronic
1114497290 14:23141739-23141761 AGAGAGACGGCCAGGCATGGTGG - Intronic
1115599559 14:34942606-34942628 AGATTCAAGGCCAGGCGTGGTGG + Intergenic
1115601110 14:34956710-34956732 AGATTTATGGCCAGGCCTGGTGG + Intergenic
1115625387 14:35186876-35186898 AGAAAGAAGGCCAGACATGGTGG - Intronic
1115887526 14:37990108-37990130 AAAGAAAACCCCAGGCCTGGAGG + Intronic
1116558095 14:46338598-46338620 AGACAGAATACCAGGCCTGGTGG + Intergenic
1116906465 14:50408376-50408398 AGATCCGAGCCCAGGTCTGGTGG - Intronic
1117054071 14:51892587-51892609 ATAAAGAAGCCCAGGCCTGGTGG - Intronic
1117680367 14:58197607-58197629 AGAAAGAAGGCCAGGCACGGTGG + Intronic
1117830963 14:59749073-59749095 ATATAGATGCCCCGGCGTGGTGG - Intronic
1118210392 14:63760842-63760864 AGGTACAAGGCCAGGCGTGGTGG - Intergenic
1118811633 14:69279217-69279239 AGATAAATGGCCAGGCGTGGTGG - Intronic
1119276794 14:73364211-73364233 ATATAGCAGGCCAGGCATGGTGG + Intronic
1119396484 14:74329862-74329884 AAAAAAAAGCCCAGGCCCGGTGG - Intronic
1119784979 14:77306249-77306271 AGTTAGCAGCCCTGGCGTGGTGG - Intronic
1120166069 14:81201870-81201892 ATATTTAAGCCCAGGCGTGGTGG + Intronic
1120320874 14:82958460-82958482 AGATAACAGGCCAGGCATGGTGG - Intergenic
1120786221 14:88539533-88539555 GGAAAGAAGGCCAGGCGTGGTGG - Intronic
1120898337 14:89554285-89554307 ACATAGTAGGCCAGGCGTGGTGG - Intronic
1121505033 14:94470555-94470577 AGATTCAAGCCCAGCCCTGTTGG - Intronic
1121664302 14:95660262-95660284 ATGAAGAAGCCCAGGACTGGAGG - Intergenic
1121873754 14:97432447-97432469 AGACAGTAGGCCAGGCGTGGTGG - Intergenic
1122215127 14:100198452-100198474 AGAAAGAAGGCCGGGCGTGGTGG + Intergenic
1122344154 14:101047761-101047783 AGAGTCAAGCCCATGCCTGGGGG - Intergenic
1122929449 14:104926625-104926647 AGACAGGAGCCCAGCCCAGGAGG + Intronic
1123957032 15:25347412-25347434 ACATAGAAGGCCAGGCATGGTGG + Intronic
1123991207 15:25684729-25684751 AGAACCAAGCCCAGGCCTTGCGG - Intronic
1124233451 15:27966846-27966868 AAATGGCAGCCCAGGCATGGTGG + Intronic
1124234671 15:27978972-27978994 AGATACAAGGCCAGGCGCGGTGG - Intronic
1124370823 15:29103792-29103814 AGACAGAAGCAGAGGCCTGGGGG + Intronic
1124897428 15:33789969-33789991 AAAAAGAAGGCCAGGCGTGGTGG - Intronic
1125795074 15:42398052-42398074 AAATAGAAGGCCAGGTGTGGTGG - Intronic
1125906144 15:43394368-43394390 AGAAAATAGCCCAGGCGTGGTGG - Intronic
1126225232 15:46262215-46262237 AGCTAGAAGATCAGGCCTGGAGG + Intergenic
1126619027 15:50617944-50617966 ACATAGAAGGCCAGGGCTGGTGG - Intronic
1126632724 15:50754082-50754104 AGAAAGAAGTCCGGGCATGGTGG - Intronic
1127188534 15:56505999-56506021 GGGTGGAGGCCCAGGCCTGGAGG - Intergenic
1128116692 15:65111941-65111963 AGATATAGGGCCAGGCGTGGTGG - Intronic
1128386309 15:67151144-67151166 AGATATAAGGCCTGGCGTGGTGG - Intronic
1128632457 15:69280446-69280468 AGAGCTTAGCCCAGGCCTGGTGG + Intergenic
1129597239 15:76974522-76974544 AGATATAAGCCCGGGTCTAGGGG + Intergenic
1129833205 15:78683791-78683813 AAATAAAAGCCCCGGCGTGGTGG + Intronic
1130606680 15:85323915-85323937 AGAATGAAGGCCAGGCATGGTGG - Intergenic
1130676093 15:85953299-85953321 AGAGAGGAGGCCAGGCATGGTGG - Intergenic
1130797068 15:87221042-87221064 AGAGAGAAACCCAGGCCTTGTGG + Intergenic
1131059889 15:89398160-89398182 AGATAGGAGCCCATGGCTGCTGG + Intergenic
1131088401 15:89598649-89598671 AGGTAGGAGGCCAGGCGTGGTGG - Intronic
1131112838 15:89776299-89776321 ACATAAAAGCTCAGGCCTGGAGG + Intronic
1131488844 15:92844489-92844511 AAAAAAAAGGCCAGGCCTGGTGG - Intergenic
1131527223 15:93162138-93162160 AGCTGAAAGCCCAGCCCTGGGGG - Intergenic
1132015970 15:98317196-98317218 GGAAAAAAGGCCAGGCCTGGTGG - Intergenic
1132318574 15:100908692-100908714 ACACAAAAGCCGAGGCCTGGAGG - Intronic
1132373968 15:101316252-101316274 AGAAAGAACCCCAGGCCAGAGGG + Intronic
1132597215 16:758550-758572 AAAAAAAAGCCCAGGCGTGGTGG - Intronic
1132682705 16:1149831-1149853 AGAGAGAAGCCCAGGACGGTTGG - Intergenic
1132744503 16:1431107-1431129 AGGTAGGAGCCAGGGCCTGGGGG + Intergenic
1132821672 16:1875700-1875722 AGATTGTAGGCCAGGCGTGGTGG + Intronic
1133541688 16:6761790-6761812 AGAGAGAGGGCCAGGCGTGGTGG - Intronic
1133794422 16:9034425-9034447 AGATTGTAGGCCAGGCATGGTGG + Intergenic
1133803158 16:9100820-9100842 AGAAAGATGGCCAGGCATGGTGG - Intronic
1133935821 16:10268346-10268368 AGAAAGAAGGCCAGGTATGGTGG + Intergenic
1134303249 16:13009887-13009909 ACATAGAAGGCCAGGCATAGTGG + Intronic
1134505912 16:14806840-14806862 AGAAAGAGGGCCAGGCATGGTGG - Intronic
1134574637 16:15321942-15321964 AGAAAGAGGGCCAGGCATGGTGG + Intergenic
1134617882 16:15665730-15665752 AGATGGAAGGCCAGGCATGGTGG - Intronic
1134727776 16:16434368-16434390 AGAAAGAGGGCCAGGCATGGTGG - Intergenic
1134915809 16:18069930-18069952 CCAGAGTAGCCCAGGCCTGGAGG + Intergenic
1134939660 16:18277459-18277481 AGAAAGAGGGCCAGGCATGGTGG + Intergenic
1135016383 16:18927454-18927476 AGAGAGAAGGCCGGGCGTGGTGG + Intergenic
1136219249 16:28817602-28817624 AATTTGAAGCCCAGGCATGGTGG - Intergenic
1136332533 16:29589776-29589798 AGAGAGGAGGCCAGGCATGGTGG + Intergenic
1136340396 16:29639345-29639367 AGAAAAAAGGCCAGGCATGGAGG + Intergenic
1136361892 16:29785881-29785903 CGATAGAGGACCAGACCTGGAGG - Intergenic
1136516407 16:30771328-30771350 AGACAGCAGGCCAGGCGTGGTGG + Intronic
1136523971 16:30815887-30815909 ATATAGTAGGCCAGGCATGGTGG + Intergenic
1136533403 16:30884782-30884804 AGATAATAGGCCAGGCATGGTGG - Intronic
1136558057 16:31020333-31020355 AGGAAGAAGGCCAGGCATGGTGG + Intergenic
1136848949 16:33598796-33598818 AGATAGGAGGCCAGGTGTGGTGG - Intergenic
1137824311 16:51477243-51477265 AATTAGAAGGCCAGGCGTGGTGG - Intergenic
1138430264 16:56963954-56963976 AGATAAAGGGCCAGGCGTGGTGG - Intronic
1138482076 16:57310204-57310226 ATAAATAAGGCCAGGCCTGGTGG - Intergenic
1138530685 16:57632750-57632772 AGATAAAAGCTCAGCCCCGGAGG + Intronic
1138633760 16:58320208-58320230 GGATAAAAGCCCAGGACTTGGGG - Intronic
1138681497 16:58686598-58686620 AGAAACAAGACCAGGCATGGTGG - Intergenic
1139287555 16:65829250-65829272 AGATCAAAGCCCAGCCCTGCGGG - Intergenic
1139373102 16:66480508-66480530 AGATAGACCCCCAGGCCTTTGGG + Intronic
1139580383 16:67869860-67869882 AGACACAAGCCCAGGCCGAGGGG - Intronic
1139610869 16:68057590-68057612 AAAAAAAAGGCCAGGCCTGGTGG + Intronic
1139632887 16:68241173-68241195 AAATAAAAGCCCGGGCATGGTGG - Intergenic
1140177345 16:72675880-72675902 AGAAAGAAGGCCGGGCGTGGTGG + Intergenic
1140405304 16:74706534-74706556 AGAAAGTAGGCCAGGCATGGTGG + Intergenic
1140522767 16:75596309-75596331 AGAAAGAAGGCCAGGCATAGTGG - Intergenic
1141151866 16:81570030-81570052 AGATTCTAGCACAGGCCTGGTGG - Intronic
1141283139 16:82647047-82647069 AGTTAAGAGCCCAGGCCTCGAGG + Intronic
1141395982 16:83705333-83705355 AAAAAGAAGCCCGGGCCCGGTGG + Intronic
1141409158 16:83820869-83820891 AGATAGAAGGGCAGGTCTGTCGG - Intergenic
1141762389 16:86037333-86037355 TAATGGCAGCCCAGGCCTGGTGG - Intergenic
1142443244 16:90115750-90115772 AGATAGCAGGCCAGGTGTGGTGG - Intergenic
1203110656 16_KI270728v1_random:1447446-1447468 AGATAGGAGGCCAGGTGTGGTGG - Intergenic
1142464150 17:119094-119116 AGATAGCAGGCCAGGTGTGGTGG + Intergenic
1142861430 17:2764433-2764455 AAATAGAAGGCCAGGCGCGGTGG + Intergenic
1143105103 17:4525676-4525698 ATATTCAAGCCCAGGCCTGTGGG - Intronic
1143273715 17:5694503-5694525 AGGAAGAAGCCAAGGGCTGGGGG + Intergenic
1143412920 17:6722892-6722914 AGTTAGAAATCCAGGCATGGAGG - Intergenic
1143513761 17:7409103-7409125 AGGAACAAGCCCAGGTCTGGCGG - Intronic
1143690153 17:8555347-8555369 AGAAAGAAGACCAGGGCTGGGGG + Intronic
1143716882 17:8779420-8779442 AGAAAGTAGGCCAGGCATGGTGG + Intergenic
1143992452 17:10977758-10977780 AGACATAAGGCCAGGCGTGGTGG - Intergenic
1145735529 17:27228417-27228439 AAATAGATGGCCAGGCATGGTGG + Intergenic
1145789859 17:27619695-27619717 AAATAAAAGACAAGGCCTGGAGG - Intronic
1145797749 17:27665771-27665793 GCACAGAAGCCCTGGCCTGGGGG - Intergenic
1146195291 17:30806958-30806980 AGATAACAGGCCAGGCATGGTGG + Intronic
1146324305 17:31872378-31872400 AAAAAGAAGGCCAGGCATGGTGG + Intronic
1146556204 17:33826499-33826521 AGATAGATTCACAGGGCTGGAGG + Intronic
1146617832 17:34370677-34370699 AGATGGAATCCCAGGACTGTGGG - Intergenic
1146653274 17:34620364-34620386 ATATAGAGGCCCTGTCCTGGTGG + Intronic
1146802805 17:35840576-35840598 AGATTGTAGGCCAGGCGTGGTGG + Intronic
1147361267 17:39931936-39931958 AGAAAATAGCCCAGGCGTGGTGG - Intergenic
1147672874 17:42186767-42186789 AGAGAGAAGGCCAGGCATGGTGG - Intergenic
1147761369 17:42799462-42799484 AAATAGAGGGCCAGGCATGGTGG + Intronic
1147801115 17:43089023-43089045 AATTAGGAGGCCAGGCCTGGTGG + Intronic
1147882655 17:43663999-43664021 AGAGAGATGGCCAGGCATGGTGG - Intergenic
1147892996 17:43730427-43730449 AGATAGGAGCACAGCCCTGCTGG + Intergenic
1147940676 17:44045311-44045333 AGATTTAAGGCCAGGCATGGTGG - Intronic
1147995467 17:44357990-44358012 GGATAGAAGCCCAGGCCATCGGG + Intronic
1148329842 17:46807193-46807215 AGAAAGAAGGCCGGGCCTGGTGG + Intronic
1148537469 17:48452259-48452281 AGATAGAAGGCCAGGCATGGTGG - Intergenic
1148695924 17:49558228-49558250 AAAAAGAAGGCCAGGCATGGTGG - Intergenic
1149759253 17:59214692-59214714 ACATACAAGGCCAGACCTGGTGG - Intronic
1150260328 17:63784619-63784641 AAATAAAAACCCAGGCATGGTGG + Intronic
1150808266 17:68336184-68336206 AGAAAGAAGACCAGGCACGGTGG - Intronic
1151280712 17:73072237-73072259 ATACAGAGGCCCAGGCCTGCAGG + Intronic
1151431719 17:74067924-74067946 AGAAAGAAACTGAGGCCTGGAGG - Intergenic
1151549469 17:74813786-74813808 AGACAGGAGGCCAGGCATGGTGG - Intronic
1151735886 17:75940226-75940248 AGAAAGAAGGCCAGGCGTGGTGG - Intronic
1151762912 17:76116840-76116862 AAATAGGAGGCCAGGCATGGTGG - Intronic
1152004069 17:77666562-77666584 AGATAGAAGCCCACGGCAGCGGG + Intergenic
1152071739 17:78137574-78137596 AGGTTGAAACCCAGGCCTTGAGG - Intronic
1152341515 17:79728419-79728441 TAATAGAATTCCAGGCCTGGGGG - Intergenic
1152358510 17:79818557-79818579 AGTTAGAAGCCCAGGCCACGTGG + Intergenic
1152515421 17:80820766-80820788 TAAAAGAAACCCAGGCCTGGAGG - Intronic
1152800048 17:82326758-82326780 AGACAGCAGCCCTGGCCTGGGGG - Intronic
1152825107 17:82459575-82459597 GGATAGAAGGCCAGGCACGGTGG + Intronic
1152947459 17:83205757-83205779 GGGGAGATGCCCAGGCCTGGCGG - Intergenic
1152947493 17:83205893-83205915 GGGGAGATGCCCAGGCCTGGCGG - Intergenic
1152947510 17:83205961-83205983 GGGGAGATGCCCAGGCCTGGCGG - Intergenic
1153442849 18:5140035-5140057 AGATAAAAGGCCAGGCATGGTGG + Intergenic
1153684620 18:7533243-7533265 AGATGCAAGCCTAGGCCTGGGGG + Intergenic
1153922104 18:9800985-9801007 AGAAAGTATCCCAGGGCTGGGGG - Intronic
1154091099 18:11364113-11364135 AGATAGAAGGCCAGGTGCGGTGG - Intergenic
1154134056 18:11760735-11760757 CCACAGAATCCCAGGCCTGGGGG - Intronic
1154444226 18:14421106-14421128 AGATCTAAGACCAGGCATGGTGG + Intergenic
1154929618 18:20979334-20979356 TGATACTAGCCCAGGCGTGGTGG + Intronic
1154936814 18:21067672-21067694 AGAGTGAAGGCCAGGCATGGTGG - Intronic
1154944603 18:21148975-21148997 AAAAAGAAGGCCAGGCCAGGTGG - Intergenic
1155195119 18:23467026-23467048 AGATATTAGGCCAGGCGTGGTGG + Intronic
1155867602 18:30985024-30985046 AGATGGGAGGCCAGGCATGGTGG - Intergenic
1156325745 18:36073290-36073312 AGATCGAAGGCCAGGCGTGGTGG - Intergenic
1156654007 18:39261883-39261905 ACAAAGAAGGCCAGGCGTGGTGG + Intergenic
1156739253 18:40304066-40304088 AGAAAAAAGGCCAGGCATGGTGG - Intergenic
1156818721 18:41343814-41343836 AGATTGAAGCCCAGGCCAAGAGG + Intergenic
1157690883 18:49680936-49680958 AGATAGAAGCCCAGGGCACTGGG + Intergenic
1157799924 18:50610770-50610792 TGATAGAAGCCCAGGAGAGGGGG - Intronic
1158108827 18:53917171-53917193 TGAGAGAAGGCCAGGCATGGTGG - Intergenic
1158122299 18:54061660-54061682 AAATAAAAGCCTAGGACTGGAGG + Intergenic
1158280522 18:55820611-55820633 AAATATTAGGCCAGGCCTGGTGG - Intergenic
1158941865 18:62412071-62412093 AGATGGGAGGCCAGGCGTGGTGG - Intergenic
1159055752 18:63462007-63462029 AAAAAAAAGGCCAGGCCTGGTGG - Intergenic
1159177527 18:64857202-64857224 AAAGAGAACGCCAGGCCTGGTGG - Intergenic
1159602113 18:70438080-70438102 ATATGCAAGGCCAGGCCTGGTGG - Intergenic
1159672054 18:71233045-71233067 GGATAGAAGGCCAGGTATGGTGG - Intergenic
1159738279 18:72131814-72131836 AAATATAAGGCCAGGCATGGTGG - Intergenic
1160007950 18:75082126-75082148 ATAAAGACGCCCAGGCCTGGGGG - Intergenic
1160181956 18:76644524-76644546 GGCTGGAGGCCCAGGCCTGGAGG + Intergenic
1160817873 19:1044604-1044626 AGAAGGCAGCCCAGACCTGGAGG + Exonic
1160999503 19:1902910-1902932 CGAAAGAAGGCCAGGCATGGTGG + Intergenic
1161023588 19:2023888-2023910 AAAAAAAAGGCCAGGCCTGGTGG + Intronic
1161094956 19:2384998-2385020 AGAGAAAAGCCCAGGCGCGGTGG + Intergenic
1161187031 19:2927937-2927959 AAAAAGAAGACCAGGCATGGTGG + Intergenic
1161659497 19:5537267-5537289 AGAAAAAAGGCCAGGCATGGTGG - Intergenic
1161704554 19:5813085-5813107 AGATGGGAGGCCAGGCATGGTGG + Intergenic
1161826049 19:6566435-6566457 AGATATCAGGCCAGGCATGGTGG - Intergenic
1162049519 19:8024354-8024376 AGAAAAAAGGCCAGGCATGGTGG - Intronic
1162116113 19:8430565-8430587 AGAGGGAGGCCTAGGCCTGGAGG + Intronic
1162209402 19:9079637-9079659 AGAGAGAAGACCGGACCTGGTGG - Intergenic
1162263860 19:9553915-9553937 AAAAAGAAGCCCAGGCGTGGTGG + Intergenic
1162317167 19:9946547-9946569 AGAAAAAAGTCCAGGCCGGGTGG - Intergenic
1162585322 19:11554648-11554670 AGAGACAAGGCCAGGCATGGTGG + Intronic
1162708627 19:12574855-12574877 AGAAAGAAGGCTAGGCGTGGTGG - Intronic
1162761325 19:12890236-12890258 AGAAAAAAGGCCAGGCATGGTGG + Intergenic
1162841281 19:13358276-13358298 ATAAAGAAGGCCAGGCGTGGTGG + Intronic
1162946980 19:14049899-14049921 ATATAGAAGGCCCGGCATGGTGG + Intronic
1163045083 19:14635390-14635412 AAATGGAAGACCAGGCATGGTGG - Intronic
1163119900 19:15211178-15211200 AGAGAGCAGGCCAGGCGTGGTGG - Intergenic
1163225414 19:15957235-15957257 AAAAAAAAGCCCAGGCATGGTGG + Intergenic
1163407773 19:17134046-17134068 AGAAAGCAGGCCAGGCATGGTGG - Intronic
1163467592 19:17477529-17477551 AGAAAGAAGGCCAGGCACGGTGG - Intronic
1163482598 19:17566824-17566846 AAATAGTAGGCCAGGCATGGTGG + Intronic
1163563237 19:18033534-18033556 AGATTGGAGGCCAGGCATGGTGG + Intergenic
1163563783 19:18037284-18037306 AAAAAGAAGGCCAGGCGTGGTGG + Intergenic
1163637476 19:18444024-18444046 AAATAGCAGGGCAGGCCTGGGGG + Exonic
1163679671 19:18673546-18673568 AAAAAAAAGCCCAGGCGTGGTGG - Intergenic
1164245213 19:23422242-23422264 AGAGAGCAGCCCAGGCCTATAGG - Intergenic
1164454155 19:28393073-28393095 AAAAAAAAGCCCAGGCATGGTGG + Intergenic
1164542313 19:29130031-29130053 AGATGGTCTCCCAGGCCTGGAGG - Intergenic
1164620047 19:29689999-29690021 TGAGAGAAGCCCAGGCATGGTGG + Intergenic
1165212468 19:34246926-34246948 AAAAAGAAGGCCCGGCCTGGTGG - Intergenic
1165468988 19:35992454-35992476 AGAAAAAAGGCCAGGCATGGTGG + Intergenic
1165777300 19:38412407-38412429 AGATAGGAGGCCAGGAGTGGTGG - Intronic
1165894065 19:39131146-39131168 GGATTGAACCCCAGGCCTTGGGG + Intronic
1166024386 19:40067652-40067674 TGACAGAAGGCCAGGCTTGGTGG + Intergenic
1166215215 19:41330525-41330547 AGATAGTAGTTCAGGCCAGGCGG - Exonic
1166251644 19:41575691-41575713 GGACAGAGACCCAGGCCTGGAGG - Intronic
1166310914 19:41962186-41962208 ACATAGAGGCAGAGGCCTGGAGG + Intergenic
1166924514 19:46257693-46257715 AGATAAAAGGCCAGGCATGGTGG - Intergenic
1167131762 19:47591377-47591399 TGATAGTTGCCCAGACCTGGGGG + Intergenic
1167209091 19:48121990-48122012 AGGCAGAAGCTCAGCCCTGGGGG + Intronic
1167284869 19:48593262-48593284 AGAGAGAAGGCCAGGTGTGGTGG + Intronic
1167299718 19:48671693-48671715 AGACCGAGGCCCAGGCCTGCAGG + Intronic
1167610140 19:50503367-50503389 ATATAATAGCCCAGGCATGGTGG - Intergenic
1167610297 19:50504416-50504438 ATATAATAGCCCAGGCATGGTGG - Intergenic
1167748462 19:51366564-51366586 AGAGAGAAGGAAAGGCCTGGCGG + Intronic
1167779999 19:51593036-51593058 GGACAGAAGGCGAGGCCTGGAGG + Intergenic
1167969035 19:53174649-53174671 AGAAAGAAGGCCAGGCATGGTGG + Intronic
1168343141 19:55637246-55637268 AGGGAGAAGGCCAGGCATGGTGG + Intronic
924964682 2:64795-64817 AGAGTGAAGGCCAGGCATGGTGG - Intergenic
925641174 2:5987032-5987054 AGAGAGAAGACCAGGCTTGGAGG - Intergenic
926062432 2:9812766-9812788 AGATGGAAGGCCAGGCACGGTGG + Intergenic
926738125 2:16089864-16089886 AAATAGAAGGCCGGGCATGGTGG - Intergenic
926881686 2:17551909-17551931 AAAAAAAAGCCCAGGCGTGGTGG + Intronic
927089828 2:19701861-19701883 AAATAGAACCCCAGGCATGGGGG - Intergenic
927861917 2:26565376-26565398 AGAAAAAAGGCCAGGCGTGGTGG - Intronic
928112915 2:28525136-28525158 ACCTACAAGCCCAGGCTTGGTGG - Intronic
928269995 2:29847311-29847333 AGATAGGAGCCCAGGTCCAGAGG - Intronic
928394856 2:30935740-30935762 GGATTGCAGGCCAGGCCTGGTGG + Intronic
928462173 2:31485257-31485279 GGCTAGAGGCCCAGGCCTGGAGG + Intergenic
928845342 2:35665133-35665155 AGACACATGCCTAGGCCTGGTGG - Intergenic
928983794 2:37160929-37160951 AGAAAGAAGGCCGGGCGTGGTGG + Intergenic
929220762 2:39462879-39462901 AGATAGTTGGCCAGGCATGGTGG + Intergenic
929453262 2:42050003-42050025 AGATGGCACCCCAGCCCTGGAGG + Intronic
929573365 2:43037328-43037350 AGCTAGAAACCCAGCCTTGGTGG - Intergenic
930032719 2:47068348-47068370 AGAAAGAAGCCTAGAGCTGGTGG - Intronic
930139032 2:47933132-47933154 AGAAAGAAGGCCGGGCATGGTGG + Intergenic
930630896 2:53753926-53753948 AGATGTAAGGCCAGGCATGGTGG - Intronic
930655434 2:54002933-54002955 AAATAAAAGGCCAGGCATGGTGG - Intronic
930856122 2:56020435-56020457 AGATAGAAGCCCACCTCTAGGGG + Intergenic
932157056 2:69427392-69427414 AAATAGAAGGCCAGGCATGGTGG + Intronic
932388997 2:71367724-71367746 AAAAAAAAGGCCAGGCCTGGTGG - Intronic
933686850 2:85148313-85148335 AGAAAGAAGCCCAAGGCTTGAGG + Intronic
933812973 2:86044559-86044581 AGATGGGAGCCCAGGTCTAGGGG - Intronic
933917319 2:87009016-87009038 AGAAAGAAAGCCAGGCATGGTGG + Intronic
934745248 2:96755393-96755415 AGATGGGAGGCCAGGCGTGGTGG - Intergenic
935135431 2:100296440-100296462 AGCGAGGACCCCAGGCCTGGCGG + Intronic
935768632 2:106394998-106395020 AGAAAGAAAGCCAGGCGTGGTGG - Intronic
935834659 2:107037268-107037290 GGCTTGAAGCCCAGACCTGGAGG - Intergenic
935839860 2:107097584-107097606 AGACAGCAACCCAGGCCTGCCGG - Intergenic
935911470 2:107900930-107900952 AGAAAGAAAGCCAGGCGTGGTGG + Intergenic
936935820 2:117837125-117837147 AGAGAGAAGCCAAGGCGTGCGGG + Intergenic
937336698 2:121066597-121066619 AGAAAGAAGCGTAGGCCTGTGGG + Intergenic
937366747 2:121267891-121267913 ACAAAGAAGTCCAGGCATGGTGG + Intronic
937397174 2:121547163-121547185 GGCTGGAGGCCCAGGCCTGGAGG - Intronic
937569031 2:123333959-123333981 GGTTAGAGACCCAGGCCTGGAGG - Intergenic
937788643 2:125932617-125932639 AGATGGAAGCCCAGATCTGAAGG - Intergenic
938105739 2:128528681-128528703 AAGGACAAGCCCAGGCCTGGTGG - Intergenic
939046155 2:137252452-137252474 AAATAAAGGGCCAGGCCTGGTGG - Intronic
940314621 2:152314837-152314859 AAAAAAAAGACCAGGCCTGGTGG - Intergenic
940315526 2:152323975-152323997 AAATACAAGGCCAGGCTTGGTGG - Intergenic
940341893 2:152590171-152590193 AGCTAGAAGGCCAGACATGGTGG - Intronic
940964364 2:159821326-159821348 ACATGGAAGGCCAGGCATGGTGG + Intronic
941179154 2:162236877-162236899 AGATAACAGGCCAGGCGTGGTGG - Intronic
941243975 2:163073747-163073769 AGATTTAAGCCCTGGTCTGGGGG + Intergenic
941922768 2:170868471-170868493 AGAAAAAGGCCCAGGCATGGTGG - Intergenic
941993099 2:171576124-171576146 AGAAAGAAGACCAGGCGTGGTGG + Intergenic
942396536 2:175555770-175555792 AGATGGAAGGCCAGGCGCGGTGG - Intergenic
942853615 2:180520381-180520403 AGATGGCAGCCCAGTCCTGAGGG + Intergenic
943439686 2:187912588-187912610 AAAGAGAAGGCCAGGCATGGTGG - Intergenic
944569181 2:201025769-201025791 AGTTAGAAGGCCAGGCATGGTGG + Intronic
945327467 2:208499228-208499250 GGATAGATGGCCAGGCATGGTGG + Intronic
946316406 2:218916730-218916752 AGAAAGGAGACCAGGCATGGTGG - Intergenic
946371158 2:219282102-219282124 TGATGGAAGGACAGGCCTGGAGG - Intronic
946421013 2:219564786-219564808 AGAAAGAAAGCCAGGCATGGTGG + Intronic
946451071 2:219779990-219780012 AGATACAGGGCCAGGCATGGTGG + Intergenic
946473120 2:219981358-219981380 AGAAAGAGGGCCTGGCCTGGTGG + Intergenic
946829595 2:223714724-223714746 AGAAAAAAGGCCAGGCCTGGTGG + Intergenic
947452167 2:230218935-230218957 ATAAAGAAGGCCAGGCATGGTGG + Intronic
947528139 2:230891869-230891891 AGATACAAACCCAGGTCTGGTGG - Intergenic
947780393 2:232755453-232755475 AGGTAAAAGGCCAGGCGTGGTGG - Intronic
947830381 2:233136188-233136210 AAATAGAAGGCCGGGCCTAGTGG + Intronic
947923745 2:233902800-233902822 AGACAGAAGCCAAGTCTTGGTGG + Intergenic
948468224 2:238162271-238162293 AGGTAGAAGGCCAGGCCACGAGG - Intronic
948600592 2:239105688-239105710 AGACCGAAGCCCAGGCCCGAGGG - Intronic
948877195 2:240836027-240836049 AGAAAGAAGGCCAGGCGCGGTGG + Intergenic
948990454 2:241551352-241551374 AGAGAGAGGCCGGGGCCTGGGGG + Intergenic
1168815734 20:735536-735558 AGATAGAAAACAAGGCATGGTGG - Intergenic
1168827613 20:824292-824314 AAATAGAAGGCCAGGCATGGTGG + Intergenic
1169047187 20:2542947-2542969 AAATACAAGGCCAGGCATGGTGG + Intronic
1169055741 20:2619258-2619280 AGATAGAAGCCCTGGGCCTGGGG - Intronic
1169397993 20:5252348-5252370 AAAGAGAAGGCCAGGCATGGTGG - Intergenic
1169449518 20:5699626-5699648 GTAGAGAAGGCCAGGCCTGGTGG - Intergenic
1169574051 20:6938753-6938775 ACATAGCAGCCCAGGCACGGTGG - Intergenic
1171282077 20:23909689-23909711 GGCTGGAGGCCCAGGCCTGGAGG + Intergenic
1171406943 20:24918005-24918027 AGCTAGCATCCCAGACCTGGTGG + Intergenic
1171784190 20:29448176-29448198 GGAAAGAAGAGCAGGCCTGGTGG + Intergenic
1171980475 20:31624658-31624680 ACATACAAGGCCAGGCATGGTGG + Intergenic
1172003383 20:31799610-31799632 AGAAAGAAGGCCAGGAATGGTGG + Intronic
1172290893 20:33775985-33776007 ATATTGAAGGCCAGGCATGGTGG - Intronic
1172343192 20:34175610-34175632 AGAGAGAAGGCCGGGCATGGTGG + Intergenic
1172779949 20:37430579-37430601 AGATAAAAACCCAGGCATTGAGG - Intergenic
1172810421 20:37643771-37643793 AGAAAGAACCCCAAGACTGGAGG + Intergenic
1173377849 20:42505587-42505609 AGACAGGAGGCCAGGCTTGGTGG - Intronic
1173518200 20:43679973-43679995 AGATAGCTGCCAAGGGCTGGAGG - Intronic
1173643524 20:44619528-44619550 ATAAAGAAGCCCATGGCTGGTGG - Exonic
1174078988 20:47957734-47957756 CCACAGAAGCCCAGGCATGGTGG + Intergenic
1174138680 20:48398060-48398082 CAACAGAAGCCCAGGCATGGTGG - Intergenic
1174214516 20:48905835-48905857 AGAAAAAAGGCCAGGCATGGTGG - Intergenic
1174400557 20:50273669-50273691 GGAGAGATGGCCAGGCCTGGCGG + Intergenic
1176103293 20:63374248-63374270 AGGAAGAAGCCCAGGGCTGAAGG + Intronic
1176360143 21:5988340-5988362 AGACAGATGCCCGTGCCTGGTGG + Intergenic
1177005224 21:15664255-15664277 ACATATGAGGCCAGGCCTGGTGG + Intergenic
1177420934 21:20855648-20855670 AGATAGTAACCCAGGTCTGTAGG + Intergenic
1177454455 21:21317820-21317842 AAAAAGAAGTCAAGGCCTGGTGG - Intronic
1177567664 21:22845344-22845366 AGAAAGAAGGTCAGGCGTGGTGG + Intergenic
1177621882 21:23606235-23606257 AGAAAAAAGCCCAGGACTGAAGG + Intergenic
1177819062 21:26011361-26011383 GAACAGAAGCCCAGGCGTGGTGG - Intronic
1178016656 21:28354229-28354251 TGATAGAGTCACAGGCCTGGCGG - Intergenic
1178086766 21:29119950-29119972 AGATTAAAGGCCAGGCATGGTGG - Intronic
1178195093 21:30335622-30335644 AGATCCAAGGCCAGGCATGGTGG + Intergenic
1178625070 21:34209394-34209416 AGATAGAAGCACAGAACTTGAGG - Intergenic
1178996941 21:37411068-37411090 AAAAAAAAGCCCAGGCGTGGTGG + Intronic
1179226635 21:39459508-39459530 AGAAAAAGGCCCAGGCATGGCGG - Intronic
1179615810 21:42582496-42582518 AGTCAGAGGCCCAGGGCTGGTGG + Intergenic
1179728171 21:43352196-43352218 AAATAGAAGCCCAGGATTGAAGG + Intergenic
1179763375 21:43550210-43550232 AGACAGATGCCCGTGCCTGGTGG - Intronic
1179784754 21:43723124-43723146 AAAAAGAAGGCCAGGCGTGGTGG - Intronic
1180187001 21:46145114-46145136 AGCCAGGAGCCCAGGCTTGGGGG - Intronic
1180556658 22:16583780-16583802 AGATACTAGCCCAGGCACGGTGG + Intergenic
1181052527 22:20244541-20244563 AGATGGCAGCCCAGGGATGGGGG + Intronic
1181255924 22:21562656-21562678 AAAAAAAAGCCCAGGCGTGGTGG - Intronic
1181319409 22:21993017-21993039 AATTAGAAGGCCAGGCATGGTGG + Intergenic
1181421830 22:22805252-22805274 ATAGAGCAGGCCAGGCCTGGTGG - Intronic
1181909557 22:26227846-26227868 AGTGAGCAGCCCAGTCCTGGAGG - Intronic
1182606181 22:31505896-31505918 AGAAAAAAGGCCAGGCATGGTGG + Intronic
1182726966 22:32455334-32455356 AAATGGAAGGCCAGGCGTGGTGG - Intronic
1182919034 22:34062591-34062613 AGATATAAGCCCGGGCCTGCCGG - Intergenic
1183353656 22:37347264-37347286 AGATGGGAGGCCAGGCGTGGTGG - Intergenic
1183644942 22:39119841-39119863 AGAAAAAAGGCCAGGCATGGTGG - Intergenic
1183662271 22:39228298-39228320 ATAAAGAAGGCCAGGCGTGGTGG + Intronic
1184180861 22:42824507-42824529 AGAAAGAAAACCAGGCATGGTGG - Intronic
1184710148 22:46244985-46245007 AGAAACAAGGCCAGGCATGGCGG + Exonic
1184959892 22:47921322-47921344 AGGGACAAACCCAGGCCTGGTGG + Intergenic
1185073573 22:48670403-48670425 CGCTGGAAGGCCAGGCCTGGTGG + Intronic
1185329921 22:50247886-50247908 AGACAGAAGCCTGGGCCAGGTGG - Exonic
949109160 3:237574-237596 AGATAAAGGCACAGGCCTTGAGG + Intronic
949694431 3:6678195-6678217 AGATAGAAGCAAATGCCTGAAGG + Intergenic
950672500 3:14535735-14535757 GGATTGAAGCCCAGGCCTTCTGG + Intronic
951000046 3:17548025-17548047 ATATAGCAGGCCAGGCATGGTGG + Intronic
951197047 3:19836099-19836121 GGCTGGAGGCCCAGGCCTGGAGG - Intergenic
951213566 3:20002630-20002652 AAATAGAAGGCCAGGCACGGTGG + Intronic
951258617 3:20480949-20480971 AAATAGCAGCTCAGGCCAGGAGG + Intergenic
953691984 3:45127491-45127513 CTATAGAAGCCCTGGCCTGCAGG + Intronic
953883998 3:46705411-46705433 AGAGACAAGGCGAGGCCTGGGGG - Intronic
953967922 3:47324330-47324352 AGGTAGAGCCCCAGGCTTGGAGG + Intronic
954156881 3:48690346-48690368 AGATAAAAGGCTAGGCGTGGTGG + Intronic
954341418 3:49956950-49956972 AAAAAGCAGGCCAGGCCTGGTGG - Intronic
954676531 3:52318765-52318787 GGAGAGAACCCCAAGCCTGGGGG + Intronic
954737688 3:52719993-52720015 AGAAAAAAGTCCAGGCTTGGTGG + Intronic
954789003 3:53116888-53116910 AAAAAGAAGCCCGGGCATGGTGG - Intronic
955362396 3:58286987-58287009 TGAAAGAAGGCCAGGCATGGTGG + Intronic
956414827 3:69014379-69014401 AGATGGAATACTAGGCCTGGGGG - Intergenic
956802831 3:72778161-72778183 AGATTGGAGGCCAGGCATGGTGG + Intronic
956915187 3:73863215-73863237 AGAAAGGAGACAAGGCCTGGTGG - Intergenic
958542846 3:95501532-95501554 AGATAGAGGGCCGGGCGTGGTGG + Intergenic
959520394 3:107317545-107317567 GGGTAGAGGTCCAGGCCTGGAGG + Intergenic
959950467 3:112175115-112175137 GGCTGGAGGCCCAGGCCTGGAGG + Intronic
960145141 3:114192990-114193012 AAAAAGAAGGCCGGGCCTGGTGG + Intronic
961000111 3:123368306-123368328 AGATGGGAGGCCAGGCATGGTGG + Intronic
961038993 3:123663804-123663826 AGCTAGATGCCAAGGCCTGAGGG + Intronic
961467332 3:127089828-127089850 AGAAAGAAGCCCGGGTCTGGGGG + Intergenic
961797829 3:129422476-129422498 AGAGAGAAGCCCAGGCATCCAGG - Intronic
962957447 3:140279235-140279257 AGAGAAAAGCCCAGGGCTGCAGG + Intronic
962997727 3:140647866-140647888 GGCTGGAGGCCCAGGCCTGGAGG + Intergenic
963053011 3:141158405-141158427 GGCTGGAGGCCCAGGCCTGGAGG - Intergenic
963104077 3:141630649-141630671 AAATTGAAGTCCAGGCGTGGTGG + Intergenic
963153302 3:142069894-142069916 AGAAAAAAGGCCAGGCGTGGTGG - Intronic
963537013 3:146542230-146542252 AGGTAGAAGTCCTGGGCTGGAGG - Intronic
964198773 3:154093843-154093865 AGAGAAAGGCCCAGGCGTGGTGG + Intergenic
964255676 3:154772260-154772282 GGCTGGAGGCCCAGGCCTGGAGG + Intergenic
965172357 3:165282420-165282442 AGATTCAGGGCCAGGCCTGGTGG - Intergenic
966000552 3:174943964-174943986 AACTGGAGGCCCAGGCCTGGGGG + Intronic
966519243 3:180855089-180855111 TCATGCAAGCCCAGGCCTGGTGG - Intronic
966679922 3:182631170-182631192 ACATAGAAGGCCAGAGCTGGAGG + Intergenic
967008550 3:185409078-185409100 AGACTGGAGGCCAGGCCTGGTGG + Intronic
968160413 3:196422211-196422233 ACAAAAAAGCCCAGGCGTGGAGG + Intronic
968252368 3:197232211-197232233 TGAAAGAAGACCAGGCATGGTGG + Intronic
968363561 3:198167138-198167160 AGATAGCAGGCCAGGTGTGGTGG - Intergenic
968775600 4:2537552-2537574 CGACAGAAGCCCGGGCCTCGCGG - Intronic
969087660 4:4668352-4668374 AGAAACAAACTCAGGCCTGGAGG - Intergenic
969230456 4:5826819-5826841 AGACAGGAGCCCAGAGCTGGGGG - Intronic
969305421 4:6323646-6323668 AGAAATAAGCCCAGGTGTGGGGG + Intronic
969640261 4:8393903-8393925 AGAGCAAACCCCAGGCCTGGAGG - Intronic
969666546 4:8560652-8560674 TGAGAGAAGCCCGGGCCCGGTGG - Intronic
970230305 4:13903204-13903226 AGATGCAAGTCCAGGCCTGAAGG - Intergenic
970548166 4:17150948-17150970 AGATAAGAGGCCAGGCGTGGTGG + Intergenic
970801373 4:19976723-19976745 ACATTGCAGCACAGGCCTGGAGG - Intergenic
971298708 4:25424487-25424509 AGAAAGAAGGCCAGGTATGGTGG - Intergenic
972327400 4:38029652-38029674 AGAAAGACGGCCAGGCGTGGTGG - Intronic
973538747 4:51912277-51912299 AGCTGGAAGACCTGGCCTGGAGG + Intronic
974199862 4:58623555-58623577 CCCTAGAAGCTCAGGCCTGGAGG - Intergenic
974223441 4:59006629-59006651 ATATATAAGGCCAGGCATGGTGG + Intergenic
974432519 4:61817097-61817119 GGATGGAAGCCCAGGTTTGGGGG + Intronic
976724247 4:88200035-88200057 AAATAGAAGGCCCGGCATGGTGG + Intronic
976764307 4:88583148-88583170 AGAAAGTAGGCCAGGCATGGTGG + Intronic
978043029 4:104092903-104092925 GGCTGGATGCCCAGGCCTGGAGG - Intergenic
978208225 4:106104967-106104989 GGCTGGAACCCCAGGCCTGGAGG - Intronic
978552746 4:109945447-109945469 AAATAGAAGGCCAGGCATGGTGG + Intronic
978762762 4:112372494-112372516 AGAAAGTAGGCCAGGCGTGGTGG - Intronic
979013116 4:115396295-115396317 GAATGGAGGCCCAGGCCTGGAGG + Intergenic
979024953 4:115558821-115558843 AGATAGCATGCAAGGCCTGGAGG + Intergenic
979337234 4:119477033-119477055 AGAAATAAGGCCAGGCCTGATGG - Intergenic
979627794 4:122865570-122865592 ACAGAGAAGGCCAGGCGTGGTGG - Intronic
980025445 4:127760750-127760772 ATATAGTAGGCCAGGCATGGTGG + Intronic
980331358 4:131415204-131415226 GGCTAGAGGCTCAGGCCTGGAGG - Intergenic
980455868 4:133042265-133042287 AGCTTGAAGGCCAGGCATGGTGG + Intergenic
981298083 4:143156138-143156160 AGGTGGAGTCCCAGGCCTGGCGG - Intergenic
982231591 4:153212893-153212915 TGATGCAAGCCCAGGCCTGGAGG - Intronic
982621324 4:157709668-157709690 ATATTTAAGGCCAGGCCTGGAGG + Intergenic
983199853 4:164849711-164849733 AGAAATTAGCCCAGGCATGGCGG + Intergenic
983768430 4:171517535-171517557 ACATAGAAGGCCAGGCATGGTGG - Intergenic
984181549 4:176489307-176489329 AGAAAGTAGCCAGGGCCTGGGGG + Intergenic
984426738 4:179597244-179597266 TGAGAGAAACCCAGGACTGGAGG - Intergenic
984548575 4:181134401-181134423 AGATATAAGGCCAGGCATGGTGG + Intergenic
984681760 4:182619138-182619160 AGCTAGAAGGCCAGGTGTGGTGG + Intronic
985200055 4:187475644-187475666 ACATAGAAGGCCGGGCCCGGTGG + Intergenic
985713620 5:1443983-1444005 CAATACAAGCCCAGGCTTGGTGG - Intronic
985744188 5:1637213-1637235 AGAGACCAGCCCAGGCCAGGAGG + Intergenic
985904601 5:2823499-2823521 GGGTAGGAGCCCCGGCCTGGGGG + Intergenic
986162325 5:5241052-5241074 AGGTATAAGCCCAGGACAGGGGG - Intronic
986707395 5:10463378-10463400 AGAGAGCAGCCCAGGGCTGGTGG + Intronic
986801587 5:11265995-11266017 AAAGAGATGACCAGGCCTGGTGG - Intronic
986956431 5:13156288-13156310 AGAGATAAGGCCAGGCGTGGTGG + Intergenic
987171061 5:15258652-15258674 AGAGACAAGGCCAGGCATGGTGG - Intergenic
987658741 5:20844185-20844207 AGATAATAGACCAGGCGTGGTGG - Intergenic
988607835 5:32695553-32695575 AAATAGAGGGCCAGGCGTGGTGG - Intronic
988764937 5:34361787-34361809 AGATAATAGACCAGGCGTGGTGG + Intergenic
989163555 5:38413702-38413724 AGAGAGGAGCCCAGGCAGGGAGG - Intronic
989386388 5:40858712-40858734 AGAAATAAGGCCAGGCGTGGCGG + Intronic
990260118 5:54013085-54013107 AGAAAGAAGTCCGGGCGTGGTGG - Intronic
990283998 5:54281412-54281434 TTATAGTAGGCCAGGCCTGGTGG - Intronic
991363431 5:65844167-65844189 AGATATAAGGCCAGGCATGGTGG + Intronic
991722285 5:69504960-69504982 AGAAAAAAGGCCAGGCCTGGTGG + Intronic
991778823 5:70112620-70112642 TAATACAAGGCCAGGCCTGGCGG - Intergenic
991858114 5:70988087-70988109 TAATACAAGGCCAGGCCTGGCGG - Intronic
991871272 5:71112973-71112995 TAATACAAGGCCAGGCCTGGCGG - Intergenic
992121637 5:73599625-73599647 AGACAAATGCCCAGGGCTGGAGG + Intergenic
992635038 5:78718853-78718875 AGAGGGAGACCCAGGCCTGGTGG + Intronic
992959957 5:81948268-81948290 CGATAGAAGGCAAGGCATGGTGG - Intergenic
993112176 5:83670978-83671000 AGAAAGAAAGCCAGGCATGGTGG - Intronic
993308971 5:86304350-86304372 AGAAATAAGGCCAGGCATGGTGG + Intergenic
994960009 5:106587668-106587690 AGAAAGAAGACCAGGCATGGTGG + Intergenic
996564507 5:124865336-124865358 AAATAAAGGGCCAGGCCTGGTGG + Intergenic
997067540 5:130579470-130579492 AGATAGAGGCCCAGTCCTCAAGG - Intergenic
997530426 5:134578389-134578411 AGAGAGAAGACGATGCCTGGTGG + Intronic
997920678 5:137976240-137976262 AAAGAGAAGGCCAGGCATGGTGG - Intronic
997920845 5:137977664-137977686 AAAGAGAAGGCCAGGCATGGTGG - Intronic
998500883 5:142631605-142631627 AGATAGAAATCAAGACCTGGGGG + Intronic
999052150 5:148534447-148534469 GGCTGGAGGCCCAGGCCTGGAGG - Intronic
999074504 5:148781441-148781463 GGCTGGAGGCCCAGGCCTGGAGG - Intergenic
999220617 5:149973785-149973807 AGATAAGAGGCCAGGCATGGTGG - Intronic
999273577 5:150313348-150313370 AAACAGAAGTCCAGGCATGGTGG - Intronic
999689638 5:154135558-154135580 GGAAAGGAGCACAGGCCTGGTGG - Intronic
999778992 5:154833953-154833975 AGATGGGAGGCCAGGCGTGGTGG - Intronic
999999574 5:157124896-157124918 AGAAAGAGGGCCAGGCATGGTGG + Intronic
1000764332 5:165266969-165266991 CGAGAGAAGGCCAGGCGTGGTGG - Intergenic
1000873497 5:166606117-166606139 AAAAACAAGCCCAGGCGTGGTGG - Intergenic
1001092655 5:168752680-168752702 AGCTGGAAGGCCAGGCATGGTGG - Intronic
1001374660 5:171244732-171244754 ATATTGAAGTCCAGGCATGGGGG - Intronic
1001996614 5:176165746-176165768 AGATAACAGGCCAGGCATGGTGG - Intergenic
1002645408 5:180650293-180650315 AGCTAGGAGGCCAGGCCTGCAGG - Intergenic
1002741403 5:181437715-181437737 GGGGAGATGCCCAGGCCTGGCGG - Intergenic
1003198297 6:3934130-3934152 ACATAGGAGGCCAGGCATGGTGG - Intergenic
1004108107 6:12685252-12685274 AGAAACCAGCCCAGGCATGGTGG + Intergenic
1004933960 6:20489685-20489707 AGAAAGATGGCCAGGCATGGTGG + Intronic
1004935471 6:20503642-20503664 AAAAAGAGGGCCAGGCCTGGTGG + Intergenic
1005009939 6:21326127-21326149 AGAAAGAAGGCCAGGCGCGGTGG - Intergenic
1005297715 6:24442866-24442888 AAATAGAAGGTCAGGCATGGTGG - Intronic
1005364759 6:25065749-25065771 ATAAAGATGGCCAGGCCTGGTGG - Intergenic
1005728356 6:28671491-28671513 AGATAGAAGCCTGGGCACGGTGG + Intergenic
1005895958 6:30178678-30178700 AGATAGAAGGCCAGGCATGGTGG - Intergenic
1005961827 6:30699196-30699218 AGATAAAAGGCCAGTCATGGCGG + Intergenic
1005975784 6:30797548-30797570 AGATCGAAGGCCAGGCACGGTGG + Intergenic
1006022298 6:31124496-31124518 AGATTCAAACCCAGGCCTGTTGG + Intronic
1006036738 6:31219588-31219610 AGAAATAAGGCCAGGCGTGGTGG + Intergenic
1006074781 6:31524973-31524995 AGATAGAGGGCCAGGCACGGTGG + Intergenic
1006357058 6:33566005-33566027 AAAAAGAAGGCCAGGCGTGGTGG - Intergenic
1006550706 6:34820937-34820959 AGACAGAGGGCCAGGCGTGGTGG - Intronic
1007224469 6:40303132-40303154 ACAGAGAAGCCTGGGCCTGGAGG - Intergenic
1007427859 6:41758983-41759005 AAAAAAAAGACCAGGCCTGGAGG + Intergenic
1007579536 6:42948879-42948901 AGAGAGATGGCCAGGCATGGTGG + Intergenic
1007988989 6:46235326-46235348 AGATAGAATCCCAGAACTAGAGG + Intronic
1008173219 6:48234583-48234605 TGTTGGAGGCCCAGGCCTGGAGG - Intergenic
1008973916 6:57402040-57402062 GGCTGGAGGCCCAGGCCTGGCGG + Intronic
1009162803 6:60303545-60303567 GGCTGGAGGCCCAGGCCTGGAGG + Intergenic
1010019060 6:71138984-71139006 GGCTAGAGACCCAGGCCTGGAGG - Intergenic
1010199760 6:73272486-73272508 AGGTAGAAGGCCAGACGTGGTGG + Intronic
1010409094 6:75540162-75540184 ACATATAAGGCCAGGCGTGGTGG + Intergenic
1010577971 6:77557034-77557056 ATACATAAGCCCAGGCATGGTGG - Intergenic
1011392330 6:86867741-86867763 GGCTGGAGGCCCAGGCCTGGAGG - Intergenic
1011507822 6:88067679-88067701 GGCTTGAGGCCCAGGCCTGGAGG + Intergenic
1011706025 6:90002481-90002503 AAATAGAAGGCCGGGCATGGTGG + Intronic
1011746046 6:90408825-90408847 AGATGCAAGACCAGGCATGGGGG - Intergenic
1012240595 6:96867399-96867421 AGAAAGAAGTCCAGGGCTGAAGG - Intergenic
1012274988 6:97262355-97262377 AGATAGCAGGCCAGGCATGGTGG + Intronic
1012347854 6:98213679-98213701 AGATAGTGGGCCAGGCGTGGTGG + Intergenic
1012817284 6:104040124-104040146 AGAGAGAAGGACAGGCATGGTGG + Intergenic
1012869006 6:104651964-104651986 AGAGAGAAGGCCAGGCGTGGTGG + Intergenic
1012962065 6:105632539-105632561 AAAAAGAAGAACAGGCCTGGAGG + Intergenic
1013103427 6:107006651-107006673 AAAAAGAAGGCCAGGCATGGTGG + Intergenic
1013275368 6:108579812-108579834 ACACAGAAGCCAAGGACTGGGGG - Intronic
1013559817 6:111292924-111292946 AAAAAAAAGGCCAGGCCTGGTGG + Intergenic
1014095891 6:117461038-117461060 AAACAGAAGGCCAGGCGTGGTGG + Intronic
1014183276 6:118407960-118407982 GGCTAGAGGCCCAGACCTGGAGG - Intergenic
1014250444 6:119110391-119110413 AGATAGAAGCTCAAGTCTGCTGG - Intronic
1014692928 6:124584362-124584384 ACATATAAGGCCAGGCATGGTGG + Intronic
1014698040 6:124648615-124648637 TGATGGAAGCCAAAGCCTGGAGG + Intronic
1015197266 6:130537261-130537283 GGCTGGAGGCCCAGGCCTGGAGG - Intergenic
1016353375 6:143192230-143192252 AGATTGAAGCACATGCATGGCGG - Intronic
1017018560 6:150121351-150121373 AGAAAGAAGGCCAGGCATGGTGG - Intergenic
1017536011 6:155348885-155348907 GGCTGGAGGCCCAGGCCTGGAGG + Intergenic
1017646832 6:156547168-156547190 ACACAGAAGGCCAGGCATGGTGG + Intergenic
1017750079 6:157483027-157483049 ATTTTGAAGGCCAGGCCTGGTGG - Intronic
1017859328 6:158380605-158380627 AGACAGGAGGCCAGGCATGGTGG + Intronic
1018289800 6:162280501-162280523 AGCTAAAAGGCCAGGCATGGTGG + Intronic
1018773287 6:166991253-166991275 AAATTGAAGGCCAGGCATGGTGG - Intergenic
1019246407 6:170712936-170712958 GGGGAGATGCCCAGGCCTGGCGG - Intergenic
1019246537 6:170713480-170713502 GGGGAGATGCCCAGGCCTGGCGG - Intergenic
1019252139 7:21545-21567 AGATAGCAGGCCAGGTGTGGTGG + Intergenic
1019488410 7:1299912-1299934 AGAGAGAGGGCCAGGCGTGGTGG + Intergenic
1019573908 7:1726953-1726975 AGATTGAAGCCCAGGGTGGGTGG + Intronic
1019731979 7:2633565-2633587 TTCTAGAAGCCCAGCCCTGGGGG + Intronic
1019774200 7:2902589-2902611 AGGTAGAAGCCCAGGGCCAGCGG + Intergenic
1020016933 7:4836583-4836605 GGATAAACGCCCAGGCCCGGAGG - Exonic
1020065978 7:5189013-5189035 AAATAGAAGGCCAGGTGTGGTGG - Intergenic
1020089244 7:5329013-5329035 TGATAGAAGGCCAGGCGTGGTGG + Intronic
1020303269 7:6812633-6812655 AGATAATAGGCCAGGCATGGTGG + Intronic
1020372022 7:7442747-7442769 AGAAAGAAGCCCAGGCGCGGTGG + Intronic
1022386870 7:29908621-29908643 AGATATCAGGCCAGGCATGGTGG + Intronic
1022469478 7:30673503-30673525 AGAAAGATGGCCAGGCATGGTGG - Intronic
1023055575 7:36287286-36287308 AGGTGGAAGGCCAGGCATGGTGG - Intronic
1023415734 7:39930644-39930666 AGAAAGAAACCCAGGCGTGGTGG - Intergenic
1023423567 7:40010394-40010416 AGATGGAGGACCAGGCGTGGTGG + Intronic
1023823190 7:43991358-43991380 AGATGGAAGTCCAGGCATGGTGG + Intergenic
1023906522 7:44526259-44526281 AGGGAGAAGGCCAGGCATGGTGG + Intronic
1024234623 7:47388575-47388597 ACATAGTAGGCCAGGCGTGGTGG + Intronic
1024635358 7:51284539-51284561 AGCTATAAGGCCAGGCATGGTGG + Intronic
1024675864 7:51637567-51637589 AGGGAGGAGACCAGGCCTGGGGG + Intergenic
1025095907 7:56095151-56095173 AAATAAAAGGCCAGGCATGGTGG - Intergenic
1025175638 7:56800489-56800511 AAATAGCAGGCCAGGCATGGTGG + Intergenic
1025696156 7:63775932-63775954 AAATAGCAGGCCAGGCATGGTGG - Intergenic
1025908434 7:65808163-65808185 AGATAGAGGACCAGGCATGGTGG - Intergenic
1025980653 7:66402576-66402598 AGAGAGAGGACCAGGCATGGTGG + Intronic
1026087466 7:67274289-67274311 GCATAGCAGGCCAGGCCTGGTGG - Intergenic
1026091507 7:67304244-67304266 AAATAAAAGGCCAGGCATGGTGG - Intergenic
1026197993 7:68189515-68189537 AGAAAAAAGGCCAGGCGTGGTGG + Intergenic
1026211869 7:68312985-68313007 AGATTTAAGGCCAGGCATGGTGG - Intergenic
1026516580 7:71078179-71078201 AGATTGGAGCCCAGCGCTGGTGG - Intergenic
1026651862 7:72222731-72222753 AGGGAGAAGGCCAGGCGTGGTGG + Intronic
1026659077 7:72283235-72283257 AGATAAACGGCCAGGCATGGTGG + Intronic
1027175036 7:75897896-75897918 AAATAGTAGGCCAGGCATGGTGG + Intergenic
1027205540 7:76094945-76094967 AGAGAGAGGACCAGGCATGGTGG + Intergenic
1027228110 7:76257461-76257483 AAAAAGAAGGCCAGGCATGGTGG + Intronic
1027627627 7:80564733-80564755 GGCTAGAGGCCCAGACCTGGAGG + Intronic
1028158875 7:87463710-87463732 AGATAGAAGGCCTGCGCTGGTGG + Intronic
1028991959 7:97058592-97058614 ACAAAAAAGGCCAGGCCTGGTGG + Intergenic
1029052167 7:97700556-97700578 GGCTAGAGGCCCAGGTCTGGAGG - Intergenic
1029186830 7:98745305-98745327 ACATGGAAGGCCAGGCGTGGTGG - Intergenic
1029377027 7:100184751-100184773 AAATAAAAGGCCAGGCATGGTGG - Intronic
1029456510 7:100674833-100674855 TACTAGCAGCCCAGGCCTGGCGG - Intronic
1029479937 7:100806245-100806267 AGATACAGGGCCAGGCCTAGTGG - Intronic
1029751453 7:102544796-102544818 AGATGGAAGTCCAGGCATGGTGG + Intronic
1029769405 7:102643889-102643911 AGATGGAAGTCCAGGCATGGTGG + Intronic
1029876963 7:103764548-103764570 AAAAAGAAGGCCAGGCATGGTGG + Intronic
1031511298 7:122653412-122653434 AAATAGAAGAGCAGGCCTTGGGG - Intronic
1031592252 7:123607772-123607794 AGGAAGAAGGCCGGGCCTGGTGG - Intronic
1031681814 7:124684095-124684117 AGATAGAAGGGGAGGCTTGGGGG - Intergenic
1031734727 7:125343618-125343640 AGACAGAAGGCCAGGCGCGGTGG - Intergenic
1032962571 7:137053813-137053835 AGAAAGTAGGCCAGGCATGGTGG - Intergenic
1033331583 7:140421176-140421198 ACATAAAAGGCCAGGCGTGGTGG - Intronic
1033370762 7:140705385-140705407 AGATACATGGCCAGGCGTGGTGG - Intronic
1033532090 7:142274519-142274541 GGCTGGAGGCCCAGGCCTGGAGG + Intergenic
1033964587 7:146959430-146959452 AGAAAGAAGCCTGGGCATGGTGG + Intronic
1034729098 7:153367923-153367945 GAATAGAAGGCCAGGCATGGTGG + Intergenic
1034743673 7:153502483-153502505 AGACAAAAGTCCAGGCATGGTGG - Intergenic
1035009211 7:155698079-155698101 ATACAGAAGGCCAGGCGTGGTGG + Intronic
1035501602 8:94481-94503 GGGGAGATGCCCAGGCCTGGCGG + Intergenic
1036528841 8:9562102-9562124 ATATATAAGGCCAGGCGTGGTGG - Intronic
1037337617 8:17807027-17807049 AAAAAGAAGGCCAGGCGTGGTGG - Intergenic
1037771459 8:21802640-21802662 AGACAGAAGGCCAGGCGTGGGGG - Intronic
1037801881 8:22040432-22040454 AGTTAGAAGGCCAGGCCTGCAGG + Intergenic
1037971535 8:23175166-23175188 GGAGAGAGGCCCTGGCCTGGAGG - Intergenic
1038145187 8:24888654-24888676 AGAGAGAGGGCCAGGCATGGTGG + Intergenic
1038820987 8:30951573-30951595 AGGTAGCAGGCCAGGCATGGCGG - Intergenic
1039019390 8:33188129-33188151 ATATATAAGGCCAGGCATGGTGG + Intergenic
1039518090 8:38149684-38149706 AGAAAGATGGCCAGGCATGGTGG + Intronic
1039616995 8:38963584-38963606 AGATTATAGGCCAGGCCTGGTGG + Intronic
1040073344 8:43205501-43205523 AGAGAGTAGCCCAGGTCTAGTGG - Intergenic
1042289943 8:67159807-67159829 AGAGAGAAGGCCGGGCGTGGTGG - Intronic
1042973939 8:74443489-74443511 AAACATAAGCCCAGGCGTGGTGG + Intronic
1043691410 8:83157835-83157857 AGAGAGTAGGCCAGGCATGGTGG - Intergenic
1043742383 8:83830129-83830151 TGATAGAAGACCAGGCGTGGTGG - Intergenic
1044162446 8:88936054-88936076 GGCTGGAGGCCCAGGCCTGGAGG - Intergenic
1044605083 8:94041348-94041370 AAAAAGAAGCCCATGCTTGGTGG - Intergenic
1044659963 8:94585395-94585417 AGATAGGAGGCCAGGCATGGTGG - Intergenic
1045379854 8:101612275-101612297 AGAGAGAAGGCCAGGCATGGTGG - Intronic
1046095062 8:109547765-109547787 ATATACAAGGCCAGGCGTGGTGG - Intronic
1047244274 8:123125445-123125467 AGATATAAAACCAGTCCTGGTGG + Intronic
1047738842 8:127790753-127790775 AGATATAGGGCCAGGCATGGTGG + Intergenic
1048453649 8:134556822-134556844 AAATAGAAGCCCAGATCTGCGGG + Intronic
1049052715 8:140211269-140211291 AGCTGGAAGGCCAGGCATGGTGG + Intronic
1049119416 8:140721042-140721064 AGGTAGGAGGCCAGGCATGGTGG - Intronic
1049192554 8:141296546-141296568 AAAAAGAAGGCCAGGCGTGGTGG + Intronic
1049277071 8:141725247-141725269 ATCCAGCAGCCCAGGCCTGGGGG + Intergenic
1049407538 8:142458299-142458321 TGATTGGAACCCAGGCCTGGTGG + Intronic
1049414705 8:142489904-142489926 ACATAGCAGCCGTGGCCTGGAGG - Intronic
1049566557 8:143343046-143343068 AGTTAGCAGGCCAGGCGTGGTGG - Intronic
1049673670 8:143880403-143880425 TGGTATAGGCCCAGGCCTGGGGG - Intergenic
1049971921 9:829129-829151 ACATAGCAGCCCAGGTGTGGCGG + Intergenic
1050019301 9:1267381-1267403 AGAAAAAAGCCTAGGCTTGGTGG + Intergenic
1050418417 9:5437830-5437852 CGAAAGGAGCCCGGGCCTGGAGG - Exonic
1050545041 9:6702504-6702526 AGAAAAAAGGCCAGGCCCGGTGG + Intergenic
1050808011 9:9706725-9706747 AGTTAGTAGGCCAGGCATGGTGG - Intronic
1051273402 9:15376626-15376648 AGATACCAGGCCAGGCATGGCGG + Intergenic
1051899733 9:22025494-22025516 GGCTAGAGGTCCAGGCCTGGAGG + Intronic
1052311627 9:27074818-27074840 GGCTGGAGGCCCAGGCCTGGTGG + Intergenic
1052339150 9:27348363-27348385 AGAAATATGGCCAGGCCTGGTGG + Intronic
1052449615 9:28612054-28612076 AAAAAGAAGCCCAGGCGTGGTGG - Intronic
1052575147 9:30281854-30281876 AGATAGCAGCATGGGCCTGGAGG + Intergenic
1052664378 9:31475762-31475784 AGATATAAACCCTGGCCTGGGGG - Intergenic
1052909271 9:33865481-33865503 ATTTAGAAGGCCAGGCGTGGTGG - Intronic
1052940637 9:34129561-34129583 AGATATCAGGCCAGGCGTGGTGG + Intergenic
1053020869 9:34693086-34693108 GGATAGAAGGCCAGGCACGGTGG - Intergenic
1053400356 9:37814433-37814455 AAATTGAAGGCCAGGCGTGGTGG - Intronic
1053488038 9:38476495-38476517 AAAAACAAGGCCAGGCCTGGTGG + Intergenic
1053488404 9:38479958-38479980 AAATAAAAGGCCAGGCGTGGTGG - Intergenic
1053604622 9:39644849-39644871 AGATAGATGGCCAGGCACGGTGG + Intergenic
1054248920 9:62697565-62697587 AGATAGATGGCCAGGCACGGTGG - Intergenic
1054563030 9:66732098-66732120 AGATAGATGGCCAGGCACGGTGG - Intergenic
1054779631 9:69154635-69154657 AAAAAGAAGGCCAGGCATGGTGG + Intronic
1055132697 9:72793831-72793853 AGCTGGAGGCCTAGGCCTGGAGG - Intronic
1055208666 9:73763053-73763075 GGCTAGAGGCCCAGGCCTAGAGG - Intergenic
1055431780 9:76251274-76251296 AGAAAGAAGGCCAGGCGCGGTGG + Intronic
1055732538 9:79293190-79293212 AGATAAAAGCCCAGCCCAGTTGG + Intergenic
1055960714 9:81817876-81817898 ATCTAGAAGCCCAGGCCCTGAGG - Intergenic
1056127884 9:83554784-83554806 GGCTGGAGGCCCAGGCCTGGAGG + Intergenic
1056598979 9:88031216-88031238 AGATAACAGGCCAGGCGTGGTGG - Intergenic
1056617619 9:88181897-88181919 AAAAACAAGCCCAGGCGTGGTGG + Intergenic
1056839827 9:89989756-89989778 ATAAAGAAGTCCAGGCCTGGTGG - Intergenic
1056893348 9:90517011-90517033 ACCTTGAATCCCAGGCCTGGGGG + Intergenic
1057243663 9:93435400-93435422 AGAGAGAAGGCCAGGCGCGGTGG - Intergenic
1057694060 9:97311137-97311159 GGATACCAGCCCAGGCCAGGGGG + Intronic
1057775112 9:98001477-98001499 AAAGAGAAGGCCAGGCATGGTGG - Intronic
1058339214 9:103873543-103873565 AAATAGAAGGCCAGGCGTGGTGG + Intergenic
1058578655 9:106430971-106430993 AGGTATAAGCAGAGGCCTGGAGG + Intergenic
1058883530 9:109305633-109305655 AAATAAAAGGCCAGGCGTGGTGG + Intronic
1058918290 9:109588521-109588543 GGATAGAAGCCAAAACCTGGCGG - Intergenic
1059132635 9:111769754-111769776 AGATTGAATCACAGGCATGGTGG - Intronic
1059499017 9:114734773-114734795 ACAAAGAAGGCCAGGCGTGGTGG - Intergenic
1059622184 9:116018894-116018916 AGAAAGAGGGCCAGGCATGGTGG - Intergenic
1059865956 9:118514187-118514209 AAAAAGAAGGCCAGGCGTGGTGG + Intergenic
1060035714 9:120254001-120254023 AGATAGATACCCAGGGATGGAGG + Intergenic
1060136937 9:121166564-121166586 AGATAGAGGCCCAGATTTGGCGG - Intronic
1060187934 9:121575211-121575233 AGATAGAAGCCCAGGCCTGGGGG - Intronic
1061044694 9:128158827-128158849 AAAAAAAAGGCCAGGCCTGGTGG - Intergenic
1061113276 9:128590939-128590961 AGAGAGAAGGCCAGCCTTGGTGG + Intronic
1061120354 9:128638229-128638251 AAAAAAAAGGCCAGGCCTGGTGG + Intronic
1061257014 9:129459276-129459298 AGGAAGTAGCCCAGGGCTGGAGG - Intergenic
1061454740 9:130689282-130689304 AAATTGAAGCCCAGGCATGGTGG + Intergenic
1061571574 9:131481012-131481034 AAAAAGAAGGCCAGGCCTGGTGG + Intronic
1061578362 9:131521986-131522008 AGAGAGAAGACCCGGCCTGTGGG + Intronic
1061578543 9:131522816-131522838 AGGCAGAACCCCAGGCCTCGGGG + Intronic
1062000576 9:134213865-134213887 GGACAGAATCCTAGGCCTGGGGG + Intergenic
1062748202 9:138230370-138230392 AGATAGCAGGCCAGGTGTGGTGG - Intergenic
1203607314 Un_KI270748v1:68931-68953 GGGGAGATGCCCAGGCCTGGCGG - Intergenic
1185493710 X:538439-538461 ATCTAGAAGGCCAGGCTTGGTGG - Intergenic
1185508708 X:647227-647249 AGAAAGTTACCCAGGCCTGGTGG - Intronic
1185508724 X:647309-647331 AGAAAGTTACCCAGGCCTGGTGG - Intronic
1185508740 X:647391-647413 AGAAAGTTACCCAGGCCTGGTGG - Intronic
1185508756 X:647473-647495 AGAAAGTTACCCAGGCCTGGTGG - Intronic
1185508773 X:647555-647577 AGAAAGTTACCCAGGCCTGGTGG - Intronic
1185508790 X:647637-647659 AGAAAGTTACCCAGGCCTGGTGG - Intronic
1185508806 X:647719-647741 AGAAAGTTACCCAGGCCTGGTGG - Intronic
1185508823 X:647801-647823 AGAAAGTTACCCAGGCCTGGTGG - Intronic
1185508839 X:647883-647905 AGAAAGTTACCCAGGCCTGGTGG - Intronic
1185508856 X:647965-647987 AGAAAGTTACCCAGGCCTGGTGG - Intronic
1185508873 X:648047-648069 AGAAAGTTACCCAGGCCTGGTGG - Intronic
1185508889 X:648129-648151 AGAAAGTTACCCAGGCCTGGTGG - Intronic
1185508905 X:648211-648233 AGAAAGTTACCCAGGCCTGGTGG - Intronic
1185508921 X:648293-648315 AGAAAGTTACCCAGGCCTGGTGG - Intronic
1185634117 X:1538761-1538783 AAAAAAAAGGCCAGGCCTGGTGG + Intergenic
1186157626 X:6742132-6742154 AGAGGGAAGGCCGGGCCTGGTGG - Intergenic
1187019677 X:15367666-15367688 AAATACAAGGCCAGGCATGGTGG + Intronic
1187170851 X:16850322-16850344 AGATAGGGGGCCAGGCATGGCGG - Intronic
1187423268 X:19155002-19155024 ATATTGAAGGCCAGGCATGGTGG + Intergenic
1187509239 X:19902797-19902819 AGACAGCAGGCCAGGCATGGTGG + Intergenic
1187879345 X:23831863-23831885 AGAAAGAAGGCCAGGCATAGTGG - Intergenic
1188546107 X:31309014-31309036 AGATGGCAGTCCAGGCGTGGTGG - Intronic
1188869712 X:35359143-35359165 GGCTGGAGGCCCAGGCCTGGAGG + Intergenic
1189103679 X:38215778-38215800 AGTTACCAGCCCAGGCCTGAAGG + Intronic
1189308385 X:40004267-40004289 AGATGGAAGGCCTGGCCTGGTGG + Intergenic
1189400246 X:40661367-40661389 AAATACAAGGCCAGGCGTGGTGG - Intronic
1189424847 X:40890213-40890235 AGATAGAAGGCCAGGTGCGGTGG + Intergenic
1189664682 X:43341384-43341406 ATAAAGAAGGCCAGGCGTGGTGG + Intergenic
1190011007 X:46784719-46784741 AAATAGATGGCCAGGCATGGTGG + Intergenic
1190069976 X:47271710-47271732 AGGAAGAAGTCCAGGCCCGGTGG + Intergenic
1190077999 X:47332851-47332873 AAAGTGAAGGCCAGGCCTGGTGG - Intergenic
1190079707 X:47346784-47346806 AGAAAAAAGGCCAGGCATGGTGG - Intergenic
1190130289 X:47741856-47741878 AAATAAAAGGCCAGGCATGGTGG + Intergenic
1190133176 X:47769295-47769317 GGCTGGAAGCCCAGGCCTAGAGG - Intergenic
1190161865 X:48037760-48037782 AGAAAGAACCCCAGCCCTAGAGG - Intronic
1190958668 X:55222910-55222932 AGATAGAAGGCCAGGTGTGGTGG + Intronic
1190964275 X:55283009-55283031 AGATAGAGGGCCAGGTGTGGTGG + Intronic
1191112639 X:56819319-56819341 ATATATAAGACCAGGCATGGTGG + Intergenic
1191116711 X:56860427-56860449 AGGTAGAGACCCAAGCCTGGTGG - Intergenic
1191738923 X:64416921-64416943 GGTTGGAGGCCCAGGCCTGGAGG + Intergenic
1192229593 X:69255936-69255958 AGGCAGCAGCCTAGGCCTGGTGG - Intergenic
1192265459 X:69534300-69534322 AGTAGGACGCCCAGGCCTGGGGG + Intergenic
1192284598 X:69721500-69721522 AAAGGGAAGCTCAGGCCTGGTGG + Intronic
1192287946 X:69758544-69758566 AGTTTGAAGGCCAGGCGTGGTGG + Intronic
1192867245 X:75147826-75147848 AGTTACAAGGCCAGGCGTGGTGG + Intronic
1193160442 X:78222639-78222661 TGAAAGAAGGCCAGGCGTGGTGG - Intergenic
1194257483 X:91652552-91652574 AGAGTGAATCCCAGGCCTGGCGG - Intergenic
1194716918 X:97297062-97297084 AAAAAAAAGGCCAGGCCTGGTGG - Intronic
1194781475 X:98029430-98029452 GGCTAGAAGCCCAGGCTTGGAGG + Intergenic
1194917508 X:99723311-99723333 GGCTAGAGGCCCAGGCCTGGAGG - Intergenic
1195392462 X:104376779-104376801 ATAAAGAAGGCCAGGCGTGGTGG - Intergenic
1195899979 X:109787499-109787521 AGAAAGTAGGCCAGGCGTGGTGG - Intergenic
1196325017 X:114392083-114392105 AGAAAGCAGACCAGGCATGGTGG - Intergenic
1196654714 X:118205525-118205547 AGATATAAAGCCAGGCATGGTGG - Intergenic
1196911366 X:120487670-120487692 AGAAAGTTTCCCAGGCCTGGAGG + Intergenic
1197122344 X:122906957-122906979 AGATGGAAGCCTAGGCCTGGAGG - Intergenic
1197187779 X:123607589-123607611 AGATACAAGGCCAGGCATGGTGG - Intronic
1197959168 X:131985482-131985504 AGACAGAAGCCAAGACATGGGGG - Intergenic
1198397827 X:136239919-136239941 AAATACAAGGCCAGGCATGGTGG + Intronic
1198863528 X:141096218-141096240 AAATAGAAGGCTGGGCCTGGTGG + Intergenic
1198899161 X:141491169-141491191 AAATAGAAGGCTGGGCCTGGTGG - Intergenic
1199140554 X:144306684-144306706 AAATAGAAGGCCAGGCGTGGTGG + Intergenic
1200307487 X:155042472-155042494 ACAAAGAAGGCCAGGCATGGTGG - Intronic
1200323914 X:155217419-155217441 AGACAGATGACCTGGCCTGGAGG - Intronic
1200576141 Y:4891498-4891520 AGAGTGAATCCCAGGCCTGGCGG - Intergenic
1200980073 Y:9255626-9255648 AAATAGAAGGCCAGGCCCTGTGG + Intergenic
1201342106 Y:12945498-12945520 AAATAGAAGGCCAAGCATGGAGG - Intergenic
1202269201 Y:23054012-23054034 GGCTAGTGGCCCAGGCCTGGAGG + Intergenic
1202422193 Y:24687752-24687774 GGCTAGTGGCCCAGGCCTGGAGG + Intergenic
1202448593 Y:24982326-24982348 GGCTAGTGGCCCAGGCCTGGAGG - Intergenic