ID: 1060187935

View in Genome Browser
Species Human (GRCh38)
Location 9:121575212-121575234
Sequence CAGATAGAAGCCCAGGCCTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 347
Summary {0: 1, 1: 0, 2: 0, 3: 37, 4: 309}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1060187935_1060187940 6 Left 1060187935 9:121575212-121575234 CCCCAGGCCTGGGCTTCTATCTG 0: 1
1: 0
2: 0
3: 37
4: 309
Right 1060187940 9:121575241-121575263 CTCCGTGTGACCTGTGAGCCAGG No data
1060187935_1060187945 29 Left 1060187935 9:121575212-121575234 CCCCAGGCCTGGGCTTCTATCTG 0: 1
1: 0
2: 0
3: 37
4: 309
Right 1060187945 9:121575264-121575286 CCAGTTGATTCTCAGAGCCTCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1060187935 Original CRISPR CAGATAGAAGCCCAGGCCTG GGG (reversed) Intronic
900008879 1:88274-88296 CAGATAGAGACACAGGCCTGTGG - Intergenic
900751005 1:4397373-4397395 GAGTGAGAAGCCCAGGGCTGTGG - Intergenic
900942298 1:5807650-5807672 CAGATCTAAACCCAGGCGTGAGG + Intergenic
902235403 1:15054132-15054154 CAGGAAGAACTCCAGGCCTGGGG + Intronic
902408024 1:16196895-16196917 CAGAGAGAATCCCAGGACTCTGG + Intergenic
902521575 1:17020811-17020833 CAGATGGAAGCCCAGGCAATAGG + Intronic
902983863 1:20143598-20143620 CTGACAGGAGCCCAGGCCTCTGG - Intronic
903051987 1:20608194-20608216 AAGTTAGAAGCCCAGGCTTCAGG + Intronic
903907886 1:26698122-26698144 CAGGGAGAAGCCCAGGCCACTGG - Intronic
904029167 1:27523301-27523323 CAGACTGGAGCCCAGGCCTAGGG + Intergenic
904296364 1:29522056-29522078 CAGAGTGAAGCCCAGGTGTGAGG - Intergenic
904302130 1:29561262-29561284 CAGCTACAGGCTCAGGCCTGGGG - Intergenic
904366176 1:30012175-30012197 CAGACATGAGCCCAGGCCCGAGG + Intergenic
904544253 1:31256084-31256106 AAAATAGAAGCCCCAGCCTGGGG - Intergenic
904567669 1:31437330-31437352 GTGACAGCAGCCCAGGCCTGGGG - Intergenic
905691019 1:39942859-39942881 CAGTCACAAGCCCAGGCCTCTGG + Intergenic
905707621 1:40073657-40073679 CAAAGAGGTGCCCAGGCCTGAGG - Exonic
905878632 1:41449279-41449301 CAGCTGGGTGCCCAGGCCTGGGG + Intergenic
906135168 1:43494297-43494319 CAAATAGAAGCTGCGGCCTGAGG - Intergenic
908514183 1:64875380-64875402 CAGAGAGAAGCAGATGCCTGTGG + Intronic
909506336 1:76394803-76394825 CAGATAGGAGCCCTGGTGTGAGG + Intronic
912723740 1:112041409-112041431 CAGACCAAAGGCCAGGCCTGAGG - Intergenic
913533123 1:119747282-119747304 TGGATAGAAGGCCAGGCCCGAGG + Intergenic
914248963 1:145906492-145906514 CAGAGAGGGGCACAGGCCTGGGG + Exonic
916186485 1:162138598-162138620 CAGACAGGAGCCCAGGCCTCTGG - Intronic
918144314 1:181742256-181742278 CAGAGAGAGGGCCTGGCCTGGGG + Intronic
920177878 1:204114448-204114470 TAGTTAGAAGCAGAGGCCTGAGG + Intronic
920200493 1:204257179-204257201 CAGACAGAACCACAGGCCAGGGG + Intronic
920396729 1:205652071-205652093 CACAAAGTAGCCCAGGCCAGTGG - Intergenic
920671828 1:208009546-208009568 CCCACAGAAGCCCAGACCTGGGG + Intergenic
921361312 1:214333278-214333300 CAGACAGCATCCCAGCCCTGTGG + Intronic
921931256 1:220756106-220756128 CAAAAGGAAGCCAAGGCCTGAGG - Intronic
923147773 1:231209937-231209959 CCTAGAGAAGCCCAGGCCTCAGG - Intronic
923723678 1:236487859-236487881 CAGTTAGAAGCCCACGTCTTGGG - Intergenic
924573369 1:245258079-245258101 TTGAGAGCAGCCCAGGCCTGGGG + Intronic
1066636107 10:37503099-37503121 CACACAGGAGCACAGGCCTGAGG - Intergenic
1066705724 10:38175631-38175653 CAGGTGGAAGCCCAGGCTTGTGG - Intergenic
1066984718 10:42454729-42454751 CAGGTGGGAGCCCAGGCTTGTGG + Intergenic
1067271049 10:44791532-44791554 CAGACAGAAACCCACACCTGAGG + Intergenic
1067370575 10:45678433-45678455 CAGGTGGGAGCCCAGGCATGTGG - Intergenic
1067389206 10:45847723-45847745 CAGGTGGGAGCCCAGGCATGTGG + Intronic
1067416864 10:46109235-46109257 CAGGTGGGAGCCCAGGCATGTGG - Intergenic
1067445051 10:46336826-46336848 CAGGTGGGAGCCCAGGCATGTGG - Intergenic
1067474983 10:46558906-46558928 TAGAGAGCAGCTCAGGCCTGAGG + Intergenic
1067502267 10:46816118-46816140 CAGGTGGGAGCCCAGGCATGTGG - Intergenic
1067592321 10:47523902-47523924 CAGGTGGGAGCCCAGGCATGTGG + Intronic
1067639437 10:48031975-48031997 CAGGTGGGAGCCCAGGCATGTGG + Intergenic
1067662464 10:48246698-48246720 CAGAACGAGGCCCAGGACTGGGG + Intronic
1067874058 10:49988330-49988352 CAGGTGGGAGCCCAGGCATGTGG - Intronic
1069016201 10:63432082-63432104 CAGAAAGAAGCTCAGCCCAGTGG + Intronic
1069784796 10:70981180-70981202 GGGATAGAAGGGCAGGCCTGAGG - Intergenic
1070136424 10:73698125-73698147 CAGGTGGGAGCCCAGGCATGTGG + Exonic
1070575310 10:77672930-77672952 CAGCTAGAATTCCAGCCCTGGGG - Intergenic
1070718917 10:78743141-78743163 CGGATTCATGCCCAGGCCTGTGG + Intergenic
1071296371 10:84223147-84223169 GGGATAGCAGCCCAGGCATGTGG - Intronic
1071504048 10:86222296-86222318 CACCTGGAAGCCCAGGCTTGGGG - Intronic
1071981868 10:91011494-91011516 GAGATAGAAGCCCAGGACAAGGG + Intergenic
1072045535 10:91651033-91651055 CAGATAGAAGCCATGGCCATAGG - Intergenic
1072690411 10:97569121-97569143 CAGACTGAAACCCAGGTCTGTGG - Intronic
1072805637 10:98422564-98422586 CAGCTAGAAGCCCAGGACAGAGG - Intronic
1073081173 10:100861887-100861909 GAGAATGAAGCCCAGGCCTTGGG - Intergenic
1073761003 10:106628698-106628720 CAGATAGAAGCCCAGGAAAAAGG + Intronic
1074322889 10:112420073-112420095 CAGAATGATGCCAAGGCCTGAGG + Intronic
1075466806 10:122657564-122657586 CAAAGAGAAGCCCAGGACAGAGG - Intergenic
1075608335 10:123832310-123832332 CACATACAAGACCAGGCCTGTGG + Intronic
1075871820 10:125776742-125776764 CAGATAAAAGCCCAGTTCAGGGG - Intergenic
1076006804 10:126954322-126954344 TACATAGCAGCCCAGGCCTCAGG - Intronic
1076186350 10:128452655-128452677 CAAAAAGAAGCCCAGGGCTTCGG + Intergenic
1076410262 10:130244313-130244335 GACATAGCACCCCAGGCCTGGGG - Intergenic
1077222353 11:1423354-1423376 CAGTTAGGAGCCGAGGCCTCTGG + Intronic
1077453406 11:2664197-2664219 CAGGAAGGAGCCCAGGCATGGGG + Intronic
1077485106 11:2834968-2834990 CAGGTTGGAGGCCAGGCCTGGGG - Intronic
1078667277 11:13336546-13336568 CAGGTAGAGGCCCAGGCTTGAGG - Intronic
1078823680 11:14906690-14906712 GAGAGAGATGTCCAGGCCTGAGG - Intronic
1079701315 11:23552210-23552232 CAGTTAGGTGCCCAGGCCAGCGG - Intergenic
1079950273 11:26793357-26793379 AAGAAAGGAGCCCAGGCTTGAGG + Intergenic
1079991242 11:27249068-27249090 CAGAGGGAAGACCAGGCCTCTGG - Intergenic
1080643677 11:34173319-34173341 CAGAGAGAGGGTCAGGCCTGGGG + Intronic
1084319793 11:68366954-68366976 CAGACAGAATCCCGGGCCTCTGG + Intronic
1085518766 11:77126210-77126232 CGGACAGTCGCCCAGGCCTGGGG - Intergenic
1087007170 11:93481855-93481877 CAGGTGGCACCCCAGGCCTGGGG + Intronic
1087411595 11:97797317-97797339 CAGATAGTAGAACAGGACTGTGG + Intergenic
1087701538 11:101441332-101441354 CAGATAGCAGACCAGTCTTGGGG - Intergenic
1090838896 11:130472997-130473019 CAGATAGAAGCCTGGACCTGAGG - Intronic
1091170705 11:133517567-133517589 CAGACAGAAACCCAGGCATCAGG + Intronic
1091327533 11:134702107-134702129 CAGAGAGAAGCTGGGGCCTGAGG - Intergenic
1091332167 11:134738143-134738165 CAGGGTGGAGCCCAGGCCTGGGG - Intergenic
1092930703 12:13312763-13312785 CAGACAGGAGGCCAGGCCAGAGG - Intergenic
1093512391 12:19944776-19944798 TAGATAACAGCTCAGGCCTGAGG - Intergenic
1093749461 12:22781579-22781601 CAGATGGCAGCCCAGGTCTAAGG + Intergenic
1095654476 12:44652795-44652817 CAGGGAGAAACGCAGGCCTGTGG - Intronic
1096500460 12:52061336-52061358 CAGATGTAAACCCAGGCCTCGGG - Intergenic
1096807869 12:54151354-54151376 CAGGTAGTAGCACAGGCCTGTGG - Intergenic
1101379113 12:104198691-104198713 CAAAAAGAAGGCCAGGCGTGGGG + Intergenic
1101772816 12:107767237-107767259 CAGTCACAAGTCCAGGCCTGTGG + Intergenic
1102290312 12:111693856-111693878 CACATAAAAGCCCAGGTATGTGG + Intronic
1103431850 12:120894574-120894596 AAGAGTGAAGCCCAAGCCTGAGG + Intronic
1103629043 12:122244506-122244528 CAGGTAGATGCCCACCCCTGAGG - Intronic
1103913464 12:124364173-124364195 CCCAGAGAAGCCCAGACCTGGGG + Intronic
1104532434 12:129584685-129584707 CAGGTTGAAGCCAAGCCCTGTGG - Intronic
1108552461 13:51560052-51560074 CAGAAAGAAGCCCAGAACTTTGG + Intergenic
1112220945 13:97488985-97489007 CAGATATAGGACTAGGCCTGAGG + Intergenic
1113917446 13:113882998-113883020 CAGGGAGATGGCCAGGCCTGCGG - Intergenic
1117070881 14:52054575-52054597 TAGCTAGAAGCACAGGCATGTGG - Intronic
1117460909 14:55943748-55943770 CTGAAAGAAGACCAGGCTTGAGG + Intergenic
1118687135 14:68302350-68302372 CAGATAGGAGTCCTGGCTTGGGG + Intronic
1118982154 14:70725560-70725582 CAGGGAAAAGCCCAGGACTGAGG + Intronic
1119385227 14:74254007-74254029 CAGCTAGAAGCCCTAGACTGGGG - Intronic
1119728228 14:76935228-76935250 CTAACAGAAGGCCAGGCCTGGGG + Intergenic
1120996962 14:90424348-90424370 CTGCTAGAAGCCCAGGTCTCAGG - Intergenic
1121258925 14:92552445-92552467 TAGCTGGAAGCCCAGCCCTGGGG + Intronic
1202905819 14_GL000194v1_random:71972-71994 CAGAGCACAGCCCAGGCCTGAGG - Intergenic
1124370822 15:29103791-29103813 GAGACAGAAGCAGAGGCCTGGGG + Intronic
1124804959 15:32872586-32872608 CATAAAGAGGCTCAGGCCTGTGG - Intronic
1128764570 15:70243284-70243306 CAGACAGAAGGCCAGGCTTCAGG - Intergenic
1129229170 15:74187191-74187213 GAGATCAAAGGCCAGGCCTGTGG - Intronic
1129284960 15:74516920-74516942 CAGATAGAAACCTGGGTCTGTGG + Intergenic
1129322622 15:74783193-74783215 CAGTTAGAAGCCCAGGTCCTAGG + Intronic
1129902327 15:79160487-79160509 CAGATTCAAACCCAAGCCTGTGG - Intergenic
1130040034 15:80398812-80398834 CACAAAGAAGCTCAGGCCTCAGG + Intronic
1130098691 15:80875612-80875634 CAGAGAAAAGCACAGGCCAGAGG - Intronic
1131050119 15:89342155-89342177 CAGACAGAACCCCTGGCCTCAGG - Intergenic
1132373967 15:101316251-101316273 TAGAAAGAACCCCAGGCCAGAGG + Intronic
1132469535 16:94243-94265 CAGAGGAAAGCTCAGGCCTGAGG + Intronic
1132744502 16:1431106-1431128 CAGGTAGGAGCCAGGGCCTGGGG + Intergenic
1132936841 16:2485612-2485634 CAGTCAGAAGTCCAGGCCTCTGG - Intronic
1134037568 16:11042440-11042462 CAGATAGGAGCCCTGGCCCGTGG + Intronic
1134093206 16:11402492-11402514 CAGTTCTAAGCCCAGGCCTTAGG + Intronic
1134821244 16:17249088-17249110 CAGATAGAATCCCCGTCCTCAGG - Intronic
1138509209 16:57498173-57498195 CAGATGGTAGCCCACGCCTCAGG + Intergenic
1138580931 16:57940045-57940067 CAGATAGCGGCCCAGGCCGTGGG - Intronic
1139287556 16:65829251-65829273 CAGATCAAAGCCCAGCCCTGCGG - Intergenic
1139325937 16:66152595-66152617 CAGAAAGATGTGCAGGCCTGAGG + Intergenic
1139373101 16:66480507-66480529 CAGATAGACCCCCAGGCCTTTGG + Intronic
1139895142 16:70282542-70282564 CAGATAAAAGCACAGCCCTGGGG - Intronic
1140126115 16:72120260-72120282 GTGAAAGAAGCCCAGGCCTGGGG + Intronic
1140744099 16:77965717-77965739 GAGATAGCTGCCCAGGCCAGGGG + Intronic
1141983565 16:87565222-87565244 CAGGTAGGAGCCCAGGACTAAGG - Intergenic
1142213412 16:88819248-88819270 CTGATGCAACCCCAGGCCTGAGG - Intronic
1142455460 16:90218690-90218712 CTGATAGAGACACAGGCCTGTGG + Intergenic
1142607151 17:1088169-1088191 CAGATTCACGGCCAGGCCTGTGG + Intronic
1143105104 17:4525677-4525699 GATATTCAAGCCCAGGCCTGTGG - Intronic
1143690152 17:8555346-8555368 GAGAAAGAAGACCAGGGCTGGGG + Intronic
1143917263 17:10303079-10303101 CAAATACAAACTCAGGCCTGAGG + Intronic
1144240378 17:13304849-13304871 CACATACAAGCCCAGTGCTGTGG - Intergenic
1145303294 17:21655169-21655191 CAGATGGACACCCCGGCCTGTGG - Intergenic
1146263477 17:31436412-31436434 CAGAGTGGAGCCGAGGCCTGGGG + Intronic
1146617833 17:34370678-34370700 CAGATGGAATCCCAGGACTGTGG - Intergenic
1147185921 17:38713045-38713067 CAGACAAGAGCCCAGGGCTGAGG - Intronic
1147309748 17:39588293-39588315 CAGGTTGGAGCCCAGGCCAGAGG + Intergenic
1147322950 17:39656957-39656979 CAGGTAGAAGCAAGGGCCTGGGG - Intronic
1147813544 17:43191577-43191599 CTGATGTAAGCCCAGGACTGGGG + Exonic
1147995466 17:44357989-44358011 CGGATAGAAGCCCAGGCCATCGG + Intronic
1148758981 17:49989684-49989706 CAGATCAAAGACCAGCCCTGAGG + Intergenic
1152004068 17:77666561-77666583 TAGATAGAAGCCCACGGCAGCGG + Intergenic
1152458483 17:80429418-80429440 CAGGGCGAATCCCAGGCCTGGGG - Intronic
1152800049 17:82326759-82326781 CAGACAGCAGCCCTGGCCTGGGG - Intronic
1152906455 17:82973107-82973129 CACTCACAAGCCCAGGCCTGGGG + Intronic
1153618453 18:6954713-6954735 CAGACAGGAGCCCAGGTCTAAGG + Intronic
1153684619 18:7533242-7533264 TAGATGCAAGCCTAGGCCTGGGG + Intergenic
1153922105 18:9800986-9801008 CAGAAAGTATCCCAGGGCTGGGG - Intronic
1156635988 18:39030150-39030172 CTGAGACAACCCCAGGCCTGAGG + Intergenic
1157473936 18:48009531-48009553 CAGATGGAAGCCCTGGTCGGTGG + Intergenic
1157690882 18:49680935-49680957 CAGATAGAAGCCCAGGGCACTGG + Intergenic
1158732852 18:60044902-60044924 CAGATGGAAGCCCAGGACACAGG + Intergenic
1159017677 18:63114946-63114968 CAGTCAGAAGTCCAGGCCTTTGG - Intergenic
1160007951 18:75082127-75082149 GATAAAGACGCCCAGGCCTGGGG - Intergenic
1160715532 19:574852-574874 CAGATAGGAGCCCATGGGTGAGG + Intronic
1160855484 19:1215331-1215353 CAGCGAGCAGACCAGGCCTGCGG + Intronic
1162529488 19:11227688-11227710 CAGGTAGAAGCTGGGGCCTGAGG + Intronic
1162770103 19:12944248-12944270 CAGATGAAATCTCAGGCCTGTGG - Exonic
1163760219 19:19132492-19132514 CAGGAAGAAGCGCAGGACTGTGG + Exonic
1163774263 19:19208561-19208583 CAGGTGGAAGCCAAGGTCTGTGG - Intergenic
1164615403 19:29664486-29664508 GAGGTAGAAGCAAAGGCCTGAGG + Intergenic
1165104161 19:33459119-33459141 CCCAGAAAAGCCCAGGCCTGTGG + Intronic
1166769989 19:45275901-45275923 CTGAAAGATGCCCATGCCTGGGG - Intronic
1167209090 19:48121989-48122011 CAGGCAGAAGCTCAGCCCTGGGG + Intronic
1168409066 19:56127365-56127387 CAGACAGCGGGCCAGGCCTGGGG - Intergenic
924999821 2:396049-396071 CACAGAGAAGCCGAGCCCTGTGG + Intergenic
925183286 2:1830706-1830728 CAGGAGGAAGGCCAGGCCTGGGG + Intronic
926218793 2:10921681-10921703 CAGACACAACCCCAGGTCTGTGG - Intergenic
926794716 2:16609437-16609459 CAGCTAGAAGCTGAGGTCTGAGG - Intronic
927089829 2:19701862-19701884 GAAATAGAACCCCAGGCATGGGG - Intergenic
928239488 2:29574245-29574267 CAGCAAGAAGCCCAGGCTTAGGG - Intronic
928434544 2:31246079-31246101 GAGAGAGAGGCCCAGGCATGGGG + Intronic
929735181 2:44540461-44540483 CAGATACGAGGCCAGGCCAGTGG + Intronic
931456517 2:62413747-62413769 CAGAAAGAAGCCCAGCTCTTTGG - Intergenic
935130934 2:100260440-100260462 AAGATTTAAACCCAGGCCTGGGG + Intergenic
935684288 2:105669903-105669925 CTGAGAGAAGCCCAAGGCTGGGG + Intergenic
936009482 2:108916357-108916379 CACAAATATGCCCAGGCCTGTGG + Intronic
936935819 2:117837124-117837146 AAGAGAGAAGCCAAGGCGTGCGG + Intergenic
937310907 2:120902827-120902849 CCTAAAGAAGCCCAGGCTTGGGG - Intronic
937336697 2:121066596-121066618 GAGAAAGAAGCGTAGGCCTGTGG + Intergenic
938108660 2:128550082-128550104 CAGACAGAAGCTCAGCACTGAGG + Intergenic
938465397 2:131521687-131521709 AAGCCAGAGGCCCAGGCCTGTGG - Intergenic
938921636 2:136000623-136000645 AAGAGAGAAACACAGGCCTGAGG - Intergenic
939665618 2:144947487-144947509 CAGTTAGATTCCCAGGCCAGGGG + Intergenic
940780236 2:157925581-157925603 CCGTTAGAAGACCAGGTCTGAGG + Intronic
942853614 2:180520380-180520402 GAGATGGCAGCCCAGTCCTGAGG + Intergenic
943771505 2:191722487-191722509 CAGTTACAAGTCCAGGCCTCTGG + Intergenic
947128979 2:226902338-226902360 CAGAAAGAAGCCCTGGGCTTTGG - Intronic
948183387 2:236000690-236000712 CAGATAGTGGCACATGCCTGAGG + Intronic
948600593 2:239105689-239105711 AAGACCGAAGCCCAGGCCCGAGG - Intronic
948840049 2:240644429-240644451 CGGAGAGAAGCCCAGGCAGGAGG + Intergenic
948893365 2:240917431-240917453 CAGCCACCAGCCCAGGCCTGAGG + Intergenic
948941951 2:241201149-241201171 CACGCAGAAGCACAGGCCTGCGG - Intronic
948990453 2:241551351-241551373 CAGAGAGAGGCCGGGGCCTGGGG + Intergenic
949086957 2:242163487-242163509 CTGATAGAGACACAGGCCTGTGG + Intergenic
1168808479 20:687177-687199 CAGACCAAAGCCCTGGCCTGAGG - Intergenic
1170486214 20:16818600-16818622 CATTTAGAAGCCCAGGGATGTGG + Intergenic
1171520811 20:25772860-25772882 CAGATGGACACCCAGGCCTGTGG - Intronic
1171556111 20:26083631-26083653 CAGATGGACACCCAGGCCTGTGG + Intergenic
1173182745 20:40816911-40816933 CAGCTGGAAGCCCAGCCCTTTGG - Intergenic
1176625176 21:9086729-9086751 CAGAGCACAGCCCAGGCCTGAGG - Intergenic
1176654673 21:9577965-9577987 CAGATGGACACCCAGGCCTGTGG - Intergenic
1177933603 21:27316267-27316289 CAGATAGAACTCCAGGCATTTGG - Intergenic
1179531110 21:42020287-42020309 TAGATAGAAGGCCTGGCATGGGG + Intergenic
1181609903 22:24005397-24005419 CAGACATAGGCCCAGGTCTGTGG - Intergenic
1181854912 22:25774691-25774713 CAGGTGGGAGCACAGGCCTGCGG + Intronic
1181929051 22:26384671-26384693 CAGAGAGCAGCCCACTCCTGAGG + Intergenic
1182317964 22:29460235-29460257 CAGGTTTAAACCCAGGCCTGTGG - Intergenic
1182368663 22:29795796-29795818 CAGAAACATACCCAGGCCTGTGG + Intronic
1182620928 22:31618163-31618185 CAGAGAGGAGCCGGGGCCTGAGG + Exonic
1182898251 22:33876195-33876217 AGGTTAGAACCCCAGGCCTGGGG + Intronic
1183317323 22:37143851-37143873 CAGAAAGTAGCACAAGCCTGTGG + Intronic
1183376098 22:37466338-37466360 CAGGGTGGAGCCCAGGCCTGAGG + Intergenic
1183505299 22:38205459-38205481 CAGAAAGGAGCCCATGCCAGCGG + Intronic
1184861025 22:47173397-47173419 AAGATACAAGCCCAGGTCAGAGG - Intronic
949095276 3:78246-78268 CAGCCAGAAGCTCAGGTCTGAGG - Intergenic
949668697 3:6372767-6372789 CAGAGAGCAGCCCAGCACTGTGG - Intergenic
950572295 3:13808954-13808976 CAGAGAGAGGCCCAGGCTGGCGG + Intergenic
953883999 3:46705412-46705434 CAGAGACAAGGCGAGGCCTGGGG - Intronic
954108319 3:48420807-48420829 CACAGGGAAGCCCAGGCCTGGGG + Intronic
954330120 3:49885378-49885400 CAGAGAGAAGTCCAGTCCTGGGG - Intergenic
956190231 3:66601051-66601073 CAGATGCAACCCCAGCCCTGTGG - Intergenic
956227436 3:66975377-66975399 CAGATATAAACCAAGGACTGTGG - Intergenic
956778415 3:72585878-72585900 CAGAGAGAAGCCTGGGTCTGAGG + Intergenic
957776163 3:84759316-84759338 CAGATACAAGCACAGGAGTGGGG + Intergenic
960036205 3:113105259-113105281 CAGAGAGCAGCCCAGGACAGAGG + Intergenic
961038992 3:123663803-123663825 AAGCTAGATGCCAAGGCCTGAGG + Intronic
961467331 3:127089827-127089849 AAGAAAGAAGCCCGGGTCTGGGG + Intergenic
964263680 3:154870228-154870250 AAAAAAAAAGCCCAGGCCTGTGG + Intergenic
968074527 3:195809255-195809277 CACACTGAAGCCCAGGCCAGAGG - Intronic
968985778 4:3873622-3873644 CACAGAGAAGCCCAGGGCTGGGG - Intergenic
969278174 4:6151004-6151026 CACATAGAAGCCAAAGCTTGGGG - Intronic
969289451 4:6229368-6229390 CAGATCCAACCCCAGGCCTTGGG - Intergenic
972369799 4:38412318-38412340 CTGGCAGGAGCCCAGGCCTGGGG + Intergenic
973696039 4:53492297-53492319 CAGCAAGAATGCCAGGCCTGAGG + Intronic
973773312 4:54225743-54225765 CAGAGAGACGCCCTGGCCTCTGG - Intronic
975169030 4:71212398-71212420 CAGGAAGAGGCCCAGGCCTCTGG + Intronic
975598506 4:76074483-76074505 CTGAGAGAAGCCCAGAACTGTGG + Intronic
977764287 4:100778356-100778378 CAGGTAGAAGTCCAGGCATTTGG - Intronic
979154193 4:117361407-117361429 CAGATAAGAGCCCAGGCCAAAGG + Intergenic
980100896 4:128540263-128540285 CTGAAAGAAGCACAGTCCTGAGG - Intergenic
982462656 4:155690283-155690305 CAGTCAGTAGCCCAGGCCTGCGG + Intronic
982993135 4:162305019-162305041 CAGATAGAATCCCAGGCCACAGG + Intergenic
986162326 5:5241053-5241075 CAGGTATAAGCCCAGGACAGGGG - Intronic
986162842 5:5246947-5246969 CAGAGAGATCTCCAGGCCTGTGG + Intronic
986749771 5:10776555-10776577 CAGAGAGAAGGCCAGGGCTCTGG + Intergenic
990689303 5:58345703-58345725 TAGAGAGAAGCCCAGGACAGAGG - Intergenic
990981873 5:61609081-61609103 CAGCTAAGAGCCCAAGCCTGTGG + Intergenic
991956369 5:71999200-71999222 CACATTGAACCCCTGGCCTGCGG + Intergenic
992615630 5:78543587-78543609 CAGCCAGAAGGCCAGGCCTGGGG - Intronic
992931846 5:81655682-81655704 CAGAGAAAAGCCAAAGCCTGAGG + Intronic
995081545 5:108056259-108056281 CAGAGAGAAGCCAAAGCCTCTGG + Intronic
995312181 5:110726441-110726463 CAGATAGCAGGCCCAGCCTGGGG + Intronic
995868501 5:116719120-116719142 CAGATTGAAAGCCAGGGCTGTGG - Intergenic
997996236 5:138589082-138589104 GAGATAGGACCCCAGGCCAGAGG - Intergenic
999261647 5:150242121-150242143 CTCCTAGAAGTCCAGGCCTGGGG + Intronic
999747093 5:154600748-154600770 CAGGTAGAAGCCCAGGGCTCTGG - Intergenic
1001701862 5:173712563-173712585 CAGAGGGAAGCCCAGGCCCTTGG - Intergenic
1002467318 5:179414049-179414071 CACAGAGAAGGCCAGGCCTGGGG + Intergenic
1003387044 6:5678452-5678474 CTGAAAGAAGCCATGGCCTGAGG - Intronic
1003954115 6:11146413-11146435 CAGAAAGAAGCCCAGGGCCCCGG + Intergenic
1004053595 6:12112721-12112743 CATCCAGAAGCCCAGCCCTGTGG - Intronic
1006368561 6:33630638-33630660 CAGCCAGAAACCCAGGCCTGTGG + Intronic
1007305234 6:40898743-40898765 AAGAAAGAAGTCCAGGGCTGTGG - Intergenic
1007778020 6:44234553-44234575 CAGGAAGAGGCCGAGGCCTGAGG + Intergenic
1009857487 6:69283314-69283336 CAGAGAGCAGCCCAGACCTGGGG + Intronic
1010198451 6:73263012-73263034 CAGGGAGTGGCCCAGGCCTGCGG - Exonic
1011552284 6:88540731-88540753 CAGATAGAGTCTCAGGCGTGCGG - Intergenic
1012919649 6:105208404-105208426 CACATATTAGCCCAGGCCTACGG + Intergenic
1016271694 6:142297459-142297481 CAGATAGAGGCCCAGGAAGGCGG + Intergenic
1017564599 6:155669962-155669984 CTAAGAGAAGCCCAGGCCGGTGG - Intergenic
1018286738 6:162248471-162248493 AAGATACAACCCCAGGCCTGTGG - Intronic
1018784626 6:167098503-167098525 CAGAGAGCACTCCAGGCCTGAGG - Intergenic
1019188478 6:170235854-170235876 CAGATGGAGGCCCAGGTCGGAGG + Intergenic
1019300939 7:303154-303176 CCAGTAGAAGCCCAGGGCTGGGG - Intergenic
1020776296 7:12458227-12458249 CAGTTAGAAGATCAGGACTGGGG - Intergenic
1022500496 7:30879566-30879588 CCGAGAGAAGCCCCAGCCTGCGG - Intronic
1022514433 7:30966274-30966296 CAGATGTAAGACCAGGGCTGGGG - Intronic
1024299780 7:47878001-47878023 CAGACAGAAACCGAAGCCTGAGG + Intronic
1024628742 7:51230477-51230499 CAGATAGAATCCCATGTGTGGGG - Intronic
1024675863 7:51637566-51637588 CAGGGAGGAGACCAGGCCTGGGG + Intergenic
1024960368 7:54968194-54968216 CAGCTCGATTCCCAGGCCTGTGG + Intergenic
1029858058 7:103539039-103539061 CAGATAGAGGGACAGGCATGTGG - Intronic
1031114600 7:117654270-117654292 CAGGTAGAGGCCCAGGGGTGAGG - Intronic
1032851983 7:135802959-135802981 CAGATCAAAGCCTAGGACTGAGG - Intergenic
1034358052 7:150469196-150469218 CAGAGAGAATCACAGGCTTGAGG - Intronic
1034419278 7:150980415-150980437 CAGAGAGGAGCCCAGGCACGGGG + Intergenic
1035337605 7:158140003-158140025 CACACAGAAGCCCAGAGCTGCGG + Intronic
1035497769 8:67853-67875 CTGATAGAGACACAGGCCTGTGG - Intergenic
1037771460 8:21802641-21802663 AAGACAGAAGGCCAGGCGTGGGG - Intronic
1037899044 8:22676868-22676890 CAGAAAGAAAGCCAGGCCTGAGG + Intergenic
1039478251 8:37852910-37852932 CTGAGAGGAGCCCAGGGCTGAGG - Intergenic
1040014755 8:42691309-42691331 CAGATGGACGCCCAGAGCTGAGG - Intergenic
1041899763 8:62968726-62968748 AAGATAGAAGGCACGGCCTGAGG - Intronic
1044735599 8:95275121-95275143 CAAACCTAAGCCCAGGCCTGTGG - Intergenic
1045480418 8:102587085-102587107 CAGAGGAGAGCCCAGGCCTGGGG + Intergenic
1048453648 8:134556821-134556843 CAAATAGAAGCCCAGATCTGCGG + Intronic
1049277070 8:141725246-141725268 CATCCAGCAGCCCAGGCCTGGGG + Intergenic
1049577577 8:143396869-143396891 AAGATAGGGTCCCAGGCCTGAGG + Intergenic
1050048656 9:1575604-1575626 CAGACACTAGCCCAGCCCTGTGG - Intergenic
1050487183 9:6146759-6146781 CAGTTATAAGCCCAGGCCTCTGG + Intergenic
1051857750 9:21588865-21588887 AATATCAAAGCCCAGGCCTGAGG + Intergenic
1052664379 9:31475763-31475785 AAGATATAAACCCTGGCCTGGGG - Intergenic
1056893347 9:90517010-90517032 CACCTTGAATCCCAGGCCTGGGG + Intergenic
1057914825 9:99047633-99047655 CAGGTAGAAGCCCCTGCCTGCGG - Intronic
1060183066 9:121547100-121547122 GAGAAAGAAGCCCAGGGCAGAGG + Intergenic
1060187935 9:121575212-121575234 CAGATAGAAGCCCAGGCCTGGGG - Intronic
1060885313 9:127148259-127148281 CAGAGAGAATCCCAGGCTGGGGG - Intronic
1061250936 9:129426023-129426045 CAGCTGGGAGCCCAGGCCAGAGG + Intergenic
1061297113 9:129682705-129682727 CAGACAAAAGCCTGGGCCTGTGG + Intronic
1061578361 9:131521985-131522007 GAGAGAGAAGACCCGGCCTGTGG + Intronic
1062115184 9:134804891-134804913 CAGAGCGAAGCCAAGGGCTGGGG - Intronic
1062282722 9:135759195-135759217 CAGACAAGCGCCCAGGCCTGAGG - Intronic
1062313138 9:135950367-135950389 CAGACAGATGCGCAGGCCAGAGG + Intronic
1203748350 Un_GL000218v1:57189-57211 CAGAGCACAGCCCAGGCCTGAGG - Intergenic
1203632393 Un_KI270750v1:81423-81445 CAGATGGACACCCAGGCCTGTGG - Intergenic
1185505447 X:630064-630086 CAGAAAGAAGCCCAGGTCCCCGG - Intronic
1186610726 X:11135706-11135728 CAGAACAAAGTCCAGGCCTGTGG - Intergenic
1186944336 X:14548681-14548703 CAAATAGAATCCCTGGCCTAAGG + Intronic
1188237858 X:27751489-27751511 CAGATGGAGTCTCAGGCCTGTGG + Intergenic
1189182717 X:39018657-39018679 CAGAGAGCAGCCTAGGGCTGGGG + Intergenic
1189214328 X:39310387-39310409 CAGCTAGAATGCCAGTCCTGTGG + Intergenic
1189496518 X:41513612-41513634 CAGATAAAATCCCATGGCTGTGG - Intergenic
1192266640 X:69543316-69543338 CAGAAAGAAGCCTAGACCTGGGG - Intergenic
1192362179 X:70446939-70446961 CAGACAGAAGGCCAGAACTGAGG - Intronic
1192363535 X:70453669-70453691 GATGTTGAAGCCCAGGCCTGTGG - Exonic
1197941934 X:131799878-131799900 CAGAAGGAAGCCCAGGCATTGGG - Intergenic
1197959169 X:131985483-131985505 CAGACAGAAGCCAAGACATGGGG - Intergenic
1198760795 X:140030271-140030293 CAGATAGAAACTGAGGCCTTTGG + Intergenic
1200207954 X:154331227-154331249 GAGATGGAAGCACTGGCCTGGGG + Intergenic
1200957682 Y:8968714-8968736 CAAATAGAAGCAGATGCCTGAGG - Intergenic
1201161697 Y:11172159-11172181 CAGAGCACAGCCCAGGCCTGAGG - Intergenic
1201783059 Y:17744372-17744394 CAGCCAGGAGCCCAGGCCAGGGG - Intergenic
1201818494 Y:18161615-18161637 CAGCCAGGAGCCCAGGCCAGGGG + Intergenic