ID: 1060187935

View in Genome Browser
Species Human (GRCh38)
Location 9:121575212-121575234
Sequence CAGATAGAAGCCCAGGCCTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1060187935_1060187945 29 Left 1060187935 9:121575212-121575234 CCCCAGGCCTGGGCTTCTATCTG No data
Right 1060187945 9:121575264-121575286 CCAGTTGATTCTCAGAGCCTCGG No data
1060187935_1060187940 6 Left 1060187935 9:121575212-121575234 CCCCAGGCCTGGGCTTCTATCTG No data
Right 1060187940 9:121575241-121575263 CTCCGTGTGACCTGTGAGCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1060187935 Original CRISPR CAGATAGAAGCCCAGGCCTG GGG (reversed) Intronic