ID: 1060187936

View in Genome Browser
Species Human (GRCh38)
Location 9:121575213-121575235
Sequence GCAGATAGAAGCCCAGGCCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 325
Summary {0: 1, 1: 0, 2: 5, 3: 32, 4: 287}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1060187936_1060187940 5 Left 1060187936 9:121575213-121575235 CCCAGGCCTGGGCTTCTATCTGC 0: 1
1: 0
2: 5
3: 32
4: 287
Right 1060187940 9:121575241-121575263 CTCCGTGTGACCTGTGAGCCAGG No data
1060187936_1060187945 28 Left 1060187936 9:121575213-121575235 CCCAGGCCTGGGCTTCTATCTGC 0: 1
1: 0
2: 5
3: 32
4: 287
Right 1060187945 9:121575264-121575286 CCAGTTGATTCTCAGAGCCTCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1060187936 Original CRISPR GCAGATAGAAGCCCAGGCCT GGG (reversed) Intronic
900661082 1:3784075-3784097 GCGGAAAGAAGCCAAGGCCAAGG - Exonic
900989554 1:6092031-6092053 GCAGACAGGGGCCCAGGCCCAGG - Intronic
901935616 1:12624583-12624605 GCAGTTAGAAGCAGTGGCCTTGG - Intergenic
902531158 1:17091520-17091542 GCAGATGGAAGCCCAGAGCAGGG - Intronic
902731728 1:18374168-18374190 GCAGATGGGAAACCAGGCCTAGG - Intronic
903440731 1:23386165-23386187 GCAGAGAGAAGGGCAAGCCTTGG - Intronic
904029166 1:27523300-27523322 CCAGACTGGAGCCCAGGCCTAGG + Intergenic
904267481 1:29326037-29326059 GCAGAGAGCATCCCAGGCCAAGG + Intronic
904302131 1:29561263-29561285 GCAGCTACAGGCTCAGGCCTGGG - Intergenic
904481369 1:30795858-30795880 GCTGAAGGAAGCCAAGGCCTGGG + Intergenic
904544254 1:31256085-31256107 GAAAATAGAAGCCCCAGCCTGGG - Intergenic
904976226 1:34458840-34458862 GGACATAGAAGCCAAGGCCTGGG + Intergenic
905389922 1:37629756-37629778 GCAGCAGGAGGCCCAGGCCTGGG + Exonic
905878631 1:41449278-41449300 GCAGCTGGGTGCCCAGGCCTGGG + Intergenic
907216264 1:52867369-52867391 GCAGAGAGAAGACCAGGCAGGGG - Intronic
907306359 1:53515247-53515269 GTAGACAGCAGCCCAGGGCTCGG + Intronic
908785892 1:67734198-67734220 CTAGATAGCAGCCCAGACCTGGG - Intronic
909056108 1:70823105-70823127 AAATATAGAAGCCCAGGTCTGGG - Intergenic
911025823 1:93434770-93434792 GCAGAGAGAAGCCCTGGAGTGGG + Intergenic
912387929 1:109281799-109281821 GCCGAGTGAAGCCCAGTCCTCGG - Exonic
912966025 1:114238301-114238323 GCTGATGCAAGCCCAGGCCAAGG - Intergenic
913563822 1:120050368-120050390 GCAGATAGAAGACCTGGCTTTGG + Intronic
913634303 1:120743195-120743217 GCAGATAGAAGACCTGGCTTTGG - Intergenic
914284415 1:146209742-146209764 GCAGATAGAAGACCTGGCTTTGG + Intronic
914545447 1:148660483-148660505 GCAGATAGAAGACCTGGCTATGG + Intronic
914621120 1:149410190-149410212 GCAGATAGAAGACCTGGCTTTGG - Intergenic
915282591 1:154832809-154832831 GGAAAGGGAAGCCCAGGCCTGGG - Intronic
915574772 1:156768116-156768138 GCAGATTGAGGCCAGGGCCTCGG - Exonic
916265966 1:162890120-162890142 GCAGATGGAAGCCCAGACCCAGG - Intergenic
916693695 1:167216254-167216276 GCAGAGGGAAGCACAGGACTGGG - Intergenic
916812259 1:168315783-168315805 GCAGACAGAAGACCTGGCCCAGG + Intergenic
917512489 1:175679931-175679953 GCAGACAGAAGCACAGTACTCGG - Intronic
917973856 1:180226245-180226267 GCAGGTAGAAGCACTTGCCTTGG + Intergenic
918144313 1:181742255-181742277 GCAGAGAGAGGGCCTGGCCTGGG + Intronic
920057927 1:203206184-203206206 GCAAGCAGAAGCCCAGGCTTAGG - Intergenic
920811864 1:209293482-209293504 CCAGGTAGATGCCCAGTCCTAGG - Intergenic
921512661 1:216051224-216051246 GCAGATAGAAACCCAGAACCAGG - Intronic
922192463 1:223331585-223331607 GCAGATAGCATCAAAGGCCTCGG - Intronic
922219846 1:223550232-223550254 GCAGATGGATCCCCAGGGCTCGG - Intronic
923068273 1:230539832-230539854 GCAGAGAGAAGACCAGGCTCAGG + Intergenic
923632348 1:235659661-235659683 GCAGAAAGAAGGGCAGCCCTCGG + Intergenic
923723679 1:236487860-236487882 GCAGTTAGAAGCCCACGTCTTGG - Intergenic
923735419 1:236602248-236602270 GCAGATAAAAGATCAGACCTTGG + Intronic
924573368 1:245258078-245258100 GTTGAGAGCAGCCCAGGCCTGGG + Intronic
1064371045 10:14751832-14751854 CGAGACTGAAGCCCAGGCCTGGG + Intronic
1064371046 10:14751843-14751865 GGAAGTGGAAGCCCAGGCCTGGG - Intronic
1065583368 10:27193790-27193812 GGAGATAGAAGTCCAGGGCCGGG - Intergenic
1065963533 10:30753121-30753143 CCAGAGAGAAGCCAAGGCCCTGG + Intergenic
1066440700 10:35436051-35436073 GGAGAGAGAAGCCCAGACATGGG + Intronic
1066954423 10:42150612-42150634 GCAGCAAAAAGCCCAGGCGTAGG + Intergenic
1069064663 10:63929986-63930008 GCAGGTAGATGAACAGGCCTGGG + Intergenic
1070833436 10:79433832-79433854 GCAGACAGAAGCCCAGGTTGGGG + Intronic
1071504049 10:86222297-86222319 GCACCTGGAAGCCCAGGCTTGGG - Intronic
1071981867 10:91011493-91011515 AGAGATAGAAGCCCAGGACAAGG + Intergenic
1072250248 10:93576254-93576276 GCAGAAATAACCCCAAGCCTGGG - Intronic
1073081174 10:100861888-100861910 TGAGAATGAAGCCCAGGCCTTGG - Intergenic
1075743788 10:124712460-124712482 GCACAGAGAAGGCCAGGCATTGG + Intronic
1075792977 10:125098791-125098813 ACAGAGAGACACCCAGGCCTCGG + Intronic
1076252028 10:128992829-128992851 GCAGATAAAAACCCTGGCCATGG + Intergenic
1076705059 10:132296989-132297011 ACAGACAGAGGCCAAGGCCTGGG + Intronic
1077232563 11:1464577-1464599 GCACACAGCAGTCCAGGCCTAGG + Intergenic
1077453405 11:2664196-2664218 GCAGGAAGGAGCCCAGGCATGGG + Intronic
1077867970 11:6238970-6238992 GCAGGTGTAAGCCCAGGCCCTGG + Intronic
1078279981 11:9891536-9891558 ACAGATATAAGCACAGGGCTTGG + Intronic
1078558004 11:12346364-12346386 GCAGATAGAAACTGAGGCTTAGG + Intronic
1080097079 11:28421232-28421254 GCAGAAAAAAGCCTAGGTCTTGG + Intergenic
1080643676 11:34173318-34173340 GCAGAGAGAGGGTCAGGCCTGGG + Intronic
1080643690 11:34173360-34173382 GCAGAGAGAGGGTCAGGCCTGGG + Intronic
1081080480 11:38733769-38733791 GAGGATGGAAGCCCAAGCCTTGG - Intergenic
1081655676 11:44855844-44855866 GCAGCAAGAAGCCCAGGCAATGG - Intronic
1081793964 11:45807197-45807219 GGGGATAGAAGCACAGGCCTGGG - Intronic
1081811846 11:45918565-45918587 GCCGAGAGAAGCCCGGGCCAGGG - Intronic
1083679563 11:64344884-64344906 GGAGGCAGAGGCCCAGGCCTGGG + Exonic
1083968107 11:66055321-66055343 GCAGGTGGCAGCCCTGGCCTTGG + Intronic
1084268154 11:68015387-68015409 GCAGGAAGCGGCCCAGGCCTTGG - Exonic
1084471086 11:69359252-69359274 GAAGGTAGGAGCCTAGGCCTGGG + Intronic
1085518767 11:77126211-77126233 GCGGACAGTCGCCCAGGCCTGGG - Intergenic
1085538595 11:77244325-77244347 GAAGATACTAGCCCAGGGCTGGG - Intronic
1086747672 11:90450583-90450605 GCAGGTAGAAGGCCAGGCTTTGG + Intergenic
1086946994 11:92853427-92853449 GGAGAGAAAAGCCCAGACCTAGG - Intronic
1087007169 11:93481854-93481876 GCAGGTGGCACCCCAGGCCTGGG + Intronic
1087701539 11:101441333-101441355 GCAGATAGCAGACCAGTCTTGGG - Intergenic
1089982587 11:122784676-122784698 ACAGTTAGAACCCCAGGGCTGGG + Intronic
1090206147 11:124885459-124885481 GCAGATAGAAGGCCAGAGCTGGG - Intronic
1091028798 11:132165062-132165084 GCAGGTAAAGCCCCAGGCCTGGG - Intronic
1091916971 12:4276765-4276787 GGAGGTAGGAACCCAGGCCTCGG - Intronic
1091968445 12:4765162-4765184 CCAGGGAGAAGGCCAGGCCTAGG - Intronic
1096500461 12:52061337-52061359 CCAGATGTAAACCCAGGCCTCGG - Intergenic
1097806771 12:63973274-63973296 CCATCTAGAAGCACAGGCCTGGG + Intronic
1097880249 12:64680287-64680309 GAAGATATAAGCTCAGGCCTTGG - Intronic
1100715576 12:97301938-97301960 GCACATAGAAAGCCATGCCTTGG - Intergenic
1102222001 12:111201127-111201149 GCAACTAGAAGCCCCGGCCAGGG - Intronic
1102581411 12:113890599-113890621 GCAGAGAGAAGCTCTGGCCACGG + Intronic
1103124501 12:118409760-118409782 GCAGCTAGCAACCCTGGCCTGGG - Intronic
1103946277 12:124528450-124528472 GCATATGGAAGCCCAGGAATGGG - Intronic
1103998084 12:124842817-124842839 GGAGACAGAGGCCCAGGGCTCGG + Intronic
1104450453 12:128864530-128864552 GCAGGTGGAAGCCCAGGAGTGGG + Intronic
1105345177 13:19564946-19564968 GCAGGCAGAAGCCCAGGCCTCGG + Intergenic
1106675044 13:31949492-31949514 GAAGATAGAAGCCTAGGATTTGG - Intergenic
1107720019 13:43238555-43238577 GCAGATGGACTTCCAGGCCTGGG + Intronic
1108746293 13:53397947-53397969 GCAGAGAGAAGCCACTGCCTGGG + Intergenic
1111046277 13:82817278-82817300 GCAGATAGAAGAGAAAGCCTAGG + Intergenic
1111353957 13:87072825-87072847 GCAGATAGAAACCAAGTCATAGG + Intergenic
1112709682 13:102113291-102113313 GAAGAGAGAAGCCCTGGTCTAGG - Intronic
1113008553 13:105736726-105736748 ACTGAGAGAACCCCAGGCCTTGG + Intergenic
1113184738 13:107675066-107675088 GCAGATAGAGGCCAAGGAATTGG + Intronic
1113740689 13:112710623-112710645 CCAGAGAGCAGCCCAGGCCCAGG - Intronic
1113767629 13:112890916-112890938 GCAGTGAGAAGCCAAGACCTCGG + Intergenic
1115053327 14:29091752-29091774 GCAAATTGAAGCCAAGTCCTTGG + Intergenic
1115481752 14:33867730-33867752 GAGGATACAAGCCCAAGCCTTGG - Intergenic
1116106650 14:40516293-40516315 GCATAGAAAAGCCCAGGACTTGG + Intergenic
1118693898 14:68364961-68364983 GCAGAGAGACGCCCATGTCTGGG + Intronic
1118761014 14:68880144-68880166 GCCGCCAGGAGCCCAGGCCTGGG - Intronic
1119385228 14:74254008-74254030 GCAGCTAGAAGCCCTAGACTGGG - Intronic
1119472146 14:74906922-74906944 GCTGATAGAGGGCCAGCCCTGGG + Exonic
1122716857 14:103701170-103701192 GAAGATAGAAGGTCAGGGCTGGG - Intronic
1124370821 15:29103790-29103812 GGAGACAGAAGCAGAGGCCTGGG + Intronic
1125362834 15:38882151-38882173 GCAGATAGAGGAGCAGGTCTTGG - Intergenic
1125862327 15:43010594-43010616 GCAGAAAGAAGTCCAGGATTTGG + Intronic
1126009488 15:44288962-44288984 GCAGGCAGAAGCCCAGGCCTCGG - Exonic
1127269848 15:57390676-57390698 GCAGGTACCAGCCCAGGCCTTGG + Intronic
1131154885 15:90068608-90068630 GCAGGCAGATGCCCAGGCCCTGG - Intronic
1131923635 15:97357787-97357809 GCAGTTAGAACTCCAGGACTGGG - Intergenic
1132203881 15:99973375-99973397 GAGGACACAAGCCCAGGCCTAGG - Exonic
1132987399 16:2774834-2774856 GCTGATGGAAGCCCAGGCTCTGG + Intronic
1133103888 16:3494716-3494738 CCAGGTAGAGGCCCAGGCCCCGG + Exonic
1133868943 16:9670071-9670093 GAAGTTAGAAGCAGAGGCCTCGG - Intronic
1134068565 16:11246254-11246276 GCAGAAATATGCCCAGGGCTGGG + Intergenic
1134278312 16:12796127-12796149 GGAGCAAGAAGCCCAGACCTAGG - Intronic
1134606050 16:15571961-15571983 GCAGAAAAAAGCACAGGCCGGGG + Intronic
1135570460 16:23545301-23545323 GGAGAAACAAGCCCAGGCCTGGG + Intronic
1136669084 16:31839704-31839726 GCAGATTGAAGCCTAGTGCTGGG - Intergenic
1137476920 16:48817271-48817293 GCAGATAGAAGCAAAGGCCACGG - Intergenic
1137720259 16:50623485-50623507 GCAGAAGGAAGACCAGGCCCAGG + Intronic
1138216042 16:55206492-55206514 GCTGATTGATGTCCAGGCCTTGG + Intergenic
1138580932 16:57940046-57940068 TCAGATAGCGGCCCAGGCCGTGG - Intronic
1138633762 16:58320210-58320232 GTGGATAAAAGCCCAGGACTTGG - Intronic
1139895143 16:70282543-70282565 CCAGATAAAAGCACAGCCCTGGG - Intronic
1140126114 16:72120259-72120281 TGTGAAAGAAGCCCAGGCCTGGG + Intronic
1140811724 16:78585263-78585285 GCCAAGAGAAGACCAGGCCTTGG + Intronic
1142722132 17:1783506-1783528 ATAGACAGAAGCCCAGTCCTAGG + Intronic
1144494094 17:15736178-15736200 TCAGTGAGAAGCCCAGGCCAGGG - Intronic
1144906166 17:18640498-18640520 TCAGTGAGAAGCCCAGGCCAGGG + Intronic
1144950241 17:18989999-18990021 ACAGAGAGAACCCTAGGCCTTGG - Intronic
1145269038 17:21394729-21394751 GCAGAGAGAAACCCTGGCATAGG + Intronic
1146263476 17:31436411-31436433 GCAGAGTGGAGCCGAGGCCTGGG + Intronic
1146488898 17:33265755-33265777 GTAGAAGGAAGCCCAGGACTGGG - Intronic
1146660349 17:34661404-34661426 GCAAATGGAAGGCCAGGTCTAGG - Intergenic
1146928284 17:36760122-36760144 GGAGCTTGGAGCCCAGGCCTGGG + Intergenic
1147322951 17:39656958-39656980 GCAGGTAGAAGCAAGGGCCTGGG - Intronic
1147454107 17:40524444-40524466 GCACAGAGAAGCTCAGGACTTGG + Intergenic
1147965552 17:44192593-44192615 GAATAGAGAAGCCCAGGCCCCGG + Exonic
1152458484 17:80429419-80429441 GCAGGGCGAATCCCAGGCCTGGG - Intronic
1152800050 17:82326760-82326782 ACAGACAGCAGCCCTGGCCTGGG - Intronic
1153947500 18:10030649-10030671 GCAGATGAAAGCACAGGCTTTGG - Intergenic
1154310815 18:13265066-13265088 GAAGGTAGAATCACAGGCCTTGG - Intronic
1155868286 18:30993452-30993474 GCATTTAAGAGCCCAGGCCTAGG + Exonic
1156098304 18:33562817-33562839 GCAGATACAAACCCATGGCTGGG - Intergenic
1158887242 18:61840006-61840028 TCAGTTAGAAACCAAGGCCTGGG + Intronic
1160007952 18:75082128-75082150 GGATAAAGACGCCCAGGCCTGGG - Intergenic
1160102785 18:75938695-75938717 GGAGATATAAACCCAGGCATTGG - Intergenic
1160244069 18:77143342-77143364 GAGGGTAGAAGCCCAAGCCTTGG + Intergenic
1160993653 19:1871992-1872014 GCAGATAAAATCCCCGGCCCTGG - Intergenic
1161341605 19:3746127-3746149 TCAGTTGGATGCCCAGGCCTCGG - Intronic
1161680687 19:5678339-5678361 GGAGCCAGAAGCCCAGGCCTCGG + Intronic
1161984869 19:7647556-7647578 GAAGGTACAAGCCCAGGCCCCGG - Intronic
1162022381 19:7873812-7873834 GCGGATGGAAGCCGAGGCCGAGG - Intronic
1162141701 19:8589329-8589351 GCAGGTCGGAGCCCAGGACTCGG + Exonic
1163703449 19:18798778-18798800 GCAGACAGGAGCCCAGGCCAGGG + Intergenic
1163737518 19:18990485-18990507 GCAGCTGGAACCCCAGCCCTGGG + Intergenic
1164648280 19:29874302-29874324 GCAGGTAGAGCCCCAGGCCCAGG + Intergenic
1164672087 19:30077996-30078018 GCAGCTAGGAGCCCAGGCTGGGG - Intergenic
1164816796 19:31210206-31210228 GCCTATAGAGGCACAGGCCTGGG + Intergenic
1165767790 19:38361813-38361835 GCAGGTAGTAGACCAGGCCCTGG - Exonic
1166769990 19:45275902-45275924 GCTGAAAGATGCCCATGCCTGGG - Intronic
925300300 2:2806989-2807011 GCAGCTGGAAGGCCAGGCCCAGG + Intergenic
926268138 2:11344513-11344535 GGAGGCTGAAGCCCAGGCCTGGG + Exonic
926362443 2:12102472-12102494 GCATATGGGAGCCCAGGGCTTGG + Intergenic
926686911 2:15705054-15705076 AAAGATAGAAGCACAGGACTTGG - Intronic
928239489 2:29574246-29574268 CCAGCAAGAAGCCCAGGCTTAGG - Intronic
930054798 2:47243828-47243850 GCAGAGAGAAGCCCTGGCAGAGG - Intergenic
932448593 2:71795574-71795596 GGTGATAGAGGCCCAGACCTTGG - Intergenic
932880674 2:75499138-75499160 GCAAATAAAAGCCCTGGACTTGG + Intronic
933974505 2:87497383-87497405 GCAGATAGAAGGACAGGCCTAGG - Intergenic
935436945 2:103045480-103045502 GCATACAGAAGCAGAGGCCTGGG - Intergenic
935684287 2:105669902-105669924 GCTGAGAGAAGCCCAAGGCTGGG + Intergenic
936319319 2:111453436-111453458 GCAGATAGAAGGACAGGCCTAGG + Intergenic
937310909 2:120902828-120902850 GCCTAAAGAAGCCCAGGCTTGGG - Intronic
938405483 2:131030685-131030707 GCAGTAAGAAGGGCAGGCCTGGG + Intronic
939887889 2:147701153-147701175 GCAGATAGGAGCCCTGTCCAGGG + Intergenic
941322241 2:164070514-164070536 ACATATAGACGGCCAGGCCTAGG + Intergenic
942362337 2:175185167-175185189 ATAGAAAGAAGCCCAGGTCTTGG + Intergenic
944899041 2:204195849-204195871 GCACACAGAAGCCCAGGGGTAGG + Intergenic
947590153 2:231380798-231380820 GCCGATGGATGCCCAGGGCTCGG + Intergenic
948867379 2:240782787-240782809 GCAGCAGGCAGCCCAGGCCTGGG - Intronic
948912327 2:241010870-241010892 GCAGCCTGAAGCCCAGGCCCTGG - Intronic
949026738 2:241769946-241769968 GCAGGAAGTAGCCCAGGCATTGG - Intergenic
1170371013 20:15648177-15648199 GAAGATAGAAGCCAAGGCTGTGG + Intronic
1170714110 20:18817340-18817362 GGAGTGGGAAGCCCAGGCCTCGG + Intronic
1171331232 20:24340362-24340384 GGAGGTGGAAGCCCAGGACTTGG - Intergenic
1172304945 20:33874145-33874167 GCAGCTGGAAGCCCAGGACGTGG + Intergenic
1172814555 20:37676135-37676157 GCAGAGAGAAGCCCAGGAACAGG - Intergenic
1173853472 20:46233750-46233772 GCAGACAGGAGCCGAGGCCCTGG - Intronic
1174048376 20:47749867-47749889 GAAGAGAGAGGCCCAGGCCTGGG - Intronic
1175332391 20:58174497-58174519 TGAAATAGAGGCCCAGGCCTTGG + Intergenic
1175954642 20:62602994-62603016 GCAGATAGAAACCCCAACCTGGG - Intergenic
1176040096 20:63060743-63060765 GCAGGAAGAAGCCCTGGCCCAGG + Intergenic
1176300285 21:5096006-5096028 GCAGATGGCTGCCCAGGCCGCGG - Intergenic
1176510737 21:7745582-7745604 CCTGCTGGAAGCCCAGGCCTCGG - Intronic
1178449094 21:32676602-32676624 GCAGCCAGAAGCGCAGGCCTAGG - Intronic
1178644850 21:34376111-34376133 CCTGCTGGAAGCCCAGGCCTCGG - Intronic
1179323983 21:40321753-40321775 GCACAGAGAGGACCAGGCCTCGG - Intronic
1179856737 21:44165905-44165927 GCAGATGGCTGCCCAGGCCGCGG + Intergenic
1181235188 22:21444285-21444307 GCAGCTGGAAGCCCAGGCTGGGG + Intronic
1181414628 22:22750483-22750505 GCAGATGCCAGGCCAGGCCTCGG + Intronic
1182346328 22:29668404-29668426 GCAGATGAAAGCCCAGGCCAGGG + Exonic
1182432718 22:30309792-30309814 GAAGAGAGAACCCCAGCCCTTGG - Intronic
1183831509 22:40420628-40420650 GCAGGTGGCAGCCCAAGCCTGGG + Intronic
1184088938 22:42282524-42282546 GCAGAACGAAGGCCAGGGCTGGG - Intronic
1185019526 22:48366118-48366140 GCAGAGAGCTTCCCAGGCCTTGG - Intergenic
1185042278 22:48511211-48511233 GGAGAGAGAAGCCCAGGCCCTGG + Intronic
1185287751 22:50010217-50010239 CCTGATGGAAGCCCCGGCCTCGG + Intronic
952980045 3:38727143-38727165 GCAGGAAGAGGCCCAGGCCGTGG - Intronic
953607639 3:44421891-44421913 GCTGAGGGAAGCCCAGGCCCTGG - Intergenic
954108318 3:48420806-48420828 CCACAGGGAAGCCCAGGCCTGGG + Intronic
954330121 3:49885379-49885401 CCAGAGAGAAGTCCAGTCCTGGG - Intergenic
954617577 3:51977380-51977402 GTAGTTAGAAGCCCATTCCTAGG + Intronic
954750874 3:52813052-52813074 CCAGCTAGAGGCCCAGGGCTGGG - Exonic
956671854 3:71698675-71698697 CCAGATAAAATCCCAGGTCTGGG - Intronic
957776162 3:84759315-84759337 GCAGATACAAGCACAGGAGTGGG + Intergenic
960115494 3:113888010-113888032 ACAGAGAAAAGCCCAGGCCCAGG + Intronic
964465824 3:156990883-156990905 GGTGATAGAAGCCCAGATCTGGG + Intronic
966287123 3:178311267-178311289 GCAGAAAGAAGCCCTGGAATGGG + Intergenic
967281300 3:187826647-187826669 GCATAGAGAGGCCCTGGCCTGGG + Intergenic
968400817 4:295495-295517 CCAGATAGATGACCAGGTCTGGG + Exonic
968985779 4:3873623-3873645 ACACAGAGAAGCCCAGGGCTGGG - Intergenic
969289452 4:6229369-6229391 TCAGATCCAACCCCAGGCCTTGG - Intergenic
969614803 4:8246189-8246211 GCAAATACAAGGCCAAGCCTAGG + Intergenic
972369798 4:38412317-38412339 GCTGGCAGGAGCCCAGGCCTGGG + Intergenic
978755129 4:112293567-112293589 GGAAATAGAATCACAGGCCTGGG - Intronic
980299134 4:130965251-130965273 GAGGGTGGAAGCCCAGGCCTTGG + Intergenic
981060846 4:140423645-140423667 GCAGATAAAAGCCCAGGACTAGG - Intronic
984261746 4:177451235-177451257 GCAGCTGGAATCCCAGGCATGGG + Intergenic
985892887 5:2729855-2729877 TCAGAAAGAAACCCAGGGCTTGG + Intergenic
986741145 5:10706458-10706480 GCAGTTAGGAGCCCAGGCTTCGG - Intronic
987930242 5:24392148-24392170 CCAGATCCAAACCCAGGCCTGGG - Intergenic
989065151 5:37452887-37452909 GGAGATAGAAGTCCAAGTCTAGG + Intronic
991960016 5:72035054-72035076 GCAGACAGCTCCCCAGGCCTGGG + Intergenic
992013441 5:72553402-72553424 ACAGATAGCTGCCCACGCCTTGG - Intergenic
992615631 5:78543588-78543610 GCAGCCAGAAGGCCAGGCCTGGG - Intronic
994418963 5:99508708-99508730 GGAGATAGAAGTCCAAGTCTAGG + Intergenic
996995788 5:129695501-129695523 GAAGAAAGAAGCCCATGCCTTGG + Intronic
998570218 5:143250353-143250375 GAAGACACAAGCTCAGGCCTGGG + Intergenic
999316126 5:150585223-150585245 CCAAATAAAAGCCCTGGCCTGGG - Intergenic
1001919811 5:175590982-175591004 GCAGTTAGGAGCACAGGCCAGGG - Intergenic
1002467317 5:179414048-179414070 GCACAGAGAAGGCCAGGCCTGGG + Intergenic
1002542519 5:179915551-179915573 GGAGATAGAAGCAGAAGCCTGGG - Intronic
1003481762 6:6540717-6540739 TCATAAAGAAACCCAGGCCTGGG - Intergenic
1004088804 6:12478514-12478536 TCAGAGTGAAGCCTAGGCCTTGG + Intergenic
1006635829 6:35460488-35460510 GCAGATAGATACTCAGGCTTGGG + Intronic
1008015251 6:46511375-46511397 GAAGAGAGAAGCCCAGGTTTTGG - Intergenic
1008512829 6:52292721-52292743 GCTGATAGAAGCCAGGGCTTGGG + Intergenic
1008537443 6:52517649-52517671 GCAGAGAGCAGCCCAGACCCAGG - Intronic
1009857486 6:69283313-69283335 CCAGAGAGCAGCCCAGACCTGGG + Intronic
1009885327 6:69617838-69617860 TAAGATAAAAGCCAAGGCCTTGG - Intergenic
1011003545 6:82618556-82618578 GAAGATGGGAGCCCAGGGCTAGG + Intergenic
1012292586 6:97476102-97476124 GGAGATATAAGCCCAGGAGTGGG + Intergenic
1012549397 6:100453767-100453789 GCAGATGGGAGCCCAGTTCTCGG + Exonic
1013041986 6:106444480-106444502 GCAAAGAGAAGCCAAGGCCGAGG - Intergenic
1016448339 6:144155526-144155548 GCACATAAAAGCTCAGGCCAAGG - Intronic
1017467992 6:154712793-154712815 ACAGAAACAAGCCCAAGCCTGGG - Intergenic
1017882869 6:158573668-158573690 GCAGCTAGAAGCGCAGGGCTGGG - Intronic
1017908223 6:158771272-158771294 GCAGATGAAGGCCCAGGCCCGGG - Exonic
1019483659 7:1277680-1277702 GCAGTTAGAAGCCAAGGTCTGGG - Intergenic
1019667368 7:2258605-2258627 GGAGAGAGAAACGCAGGCCTAGG + Intronic
1019788246 7:2993309-2993331 GGACATGGAAGCCCAGGCCATGG + Intronic
1022514434 7:30966275-30966297 GCAGATGTAAGACCAGGGCTGGG - Intronic
1024610330 7:51058891-51058913 ACAGACAGTAGCCCCGGCCTGGG - Intronic
1024675862 7:51637565-51637587 GCAGGGAGGAGACCAGGCCTGGG + Intergenic
1027054750 7:75042460-75042482 CCAGATGGAATCCCAGGCCACGG + Exonic
1030900781 7:115120719-115120741 GCAGAGACAGACCCAGGCCTAGG - Intergenic
1031901415 7:127415290-127415312 GGAGATAGCAGGGCAGGCCTAGG + Intronic
1032385416 7:131519401-131519423 GTAGATAGAGGACCAGGCCTGGG - Intronic
1034537131 7:151732432-151732454 GGAGATAGAATCTCAGGGCTGGG - Intronic
1035599528 8:889435-889457 GCAGCTAGGGGCTCAGGCCTAGG + Intergenic
1035835150 8:2742197-2742219 GTAGATAAAAGCACAGTCCTGGG - Intergenic
1036520995 8:9491579-9491601 GCAGAATGAAGCCCAAGCCCTGG - Intergenic
1037771461 8:21802642-21802664 GAAGACAGAAGGCCAGGCGTGGG - Intronic
1038041316 8:23726645-23726667 GCAGATCTAAGGCCAGACCTGGG - Intergenic
1038447413 8:27613504-27613526 GCAGATAGGAGCCGGGGCTTTGG - Intronic
1041119234 8:54569842-54569864 TCAGAAAGAAGCCCAGTCATAGG + Intergenic
1044132779 8:88546582-88546604 TCAGATTGAATCCCAAGCCTGGG - Intergenic
1044873880 8:96645445-96645467 GCGGGTAGGAGCCAAGGCCTCGG - Intronic
1045043367 8:98248895-98248917 GCACAGGGATGCCCAGGCCTGGG - Intronic
1045326942 8:101124135-101124157 GCAGTTAGGTACCCAGGCCTTGG + Intergenic
1045480417 8:102587084-102587106 GCAGAGGAGAGCCCAGGCCTGGG + Intergenic
1048278925 8:133090289-133090311 GCAGAGAGAAGCCCTGGGTTTGG + Intronic
1048424030 8:134306119-134306141 GGAGAATGATGCCCAGGCCTTGG + Intergenic
1048609359 8:136005122-136005144 GAAGAGAGAAGCCCAGGGCCAGG + Intergenic
1049243477 8:141550212-141550234 GCAGATACAGGCCCAGCTCTGGG - Intergenic
1049529928 8:143149065-143149087 GGGGACAGAAGACCAGGCCTGGG + Intergenic
1051494795 9:17708148-17708170 GAAGAAAGAAGCCAAGACCTTGG - Intronic
1053000530 9:34574993-34575015 GCATATACAAGCCCATGCCCAGG - Intronic
1055428428 9:76219098-76219120 GCAGCTAGAGCCCCAGGCCTTGG + Intronic
1055779722 9:79807494-79807516 GCTGATAGAAACTCAGACCTTGG + Intergenic
1060187936 9:121575213-121575235 GCAGATAGAAGCCCAGGCCTGGG - Intronic
1060409262 9:123389350-123389372 GCAGAGAAAAGCCCAGCACTGGG - Intronic
1060464218 9:123888065-123888087 GTATTTAGAAGCCAAGGCCTGGG - Intronic
1060885314 9:127148260-127148282 GCAGAGAGAATCCCAGGCTGGGG - Intronic
1060937893 9:127526606-127526628 GCAGCCAGAAGGACAGGCCTGGG - Intronic
1061083276 9:128385000-128385022 ACACATGGAAGCACAGGCCTGGG + Intronic
1061578541 9:131522814-131522836 GAAGGCAGAACCCCAGGCCTCGG + Intronic
1061742366 9:132716543-132716565 TCAGTTCCAAGCCCAGGCCTGGG - Intergenic
1186225248 X:7392135-7392157 GCAAATAGAAGGCCAGGCCATGG + Intergenic
1189760211 X:44314473-44314495 GCAGATAACAGCCCAGCTCTAGG + Intronic
1192184298 X:68936288-68936310 GCTGAGAGAAGCCCAGACTTGGG + Intergenic
1192266641 X:69543317-69543339 ACAGAAAGAAGCCTAGACCTGGG - Intergenic
1192447383 X:71221235-71221257 GCATATAGAATCCCAGGCTTGGG + Intronic
1192636310 X:72822917-72822939 GCAGAGAGAAGCTCAGACATTGG - Intronic
1192645404 X:72897897-72897919 GCAGAGAGAAGCTCAGACATTGG + Intronic
1196710037 X:118753182-118753204 GCAGATGGTAGCCTAGTCCTTGG + Intronic
1197941935 X:131799879-131799901 GCAGAAGGAAGCCCAGGCATTGG - Intergenic
1200230681 X:154442442-154442464 GCAGCCAGGAGCCCAGGGCTGGG - Intronic
1201270753 Y:12251630-12251652 GCAGAACGAAAACCAGGCCTGGG + Intergenic
1201594781 Y:15656122-15656144 GCAAATAGAAGGCCAGGCCATGG + Intergenic