ID: 1060187937

View in Genome Browser
Species Human (GRCh38)
Location 9:121575214-121575236
Sequence AGCAGATAGAAGCCCAGGCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 440
Summary {0: 1, 1: 0, 2: 11, 3: 27, 4: 401}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1060187937_1060187946 30 Left 1060187937 9:121575214-121575236 CCAGGCCTGGGCTTCTATCTGCT 0: 1
1: 0
2: 11
3: 27
4: 401
Right 1060187946 9:121575267-121575289 GTTGATTCTCAGAGCCTCGGAGG No data
1060187937_1060187940 4 Left 1060187937 9:121575214-121575236 CCAGGCCTGGGCTTCTATCTGCT 0: 1
1: 0
2: 11
3: 27
4: 401
Right 1060187940 9:121575241-121575263 CTCCGTGTGACCTGTGAGCCAGG No data
1060187937_1060187945 27 Left 1060187937 9:121575214-121575236 CCAGGCCTGGGCTTCTATCTGCT 0: 1
1: 0
2: 11
3: 27
4: 401
Right 1060187945 9:121575264-121575286 CCAGTTGATTCTCAGAGCCTCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1060187937 Original CRISPR AGCAGATAGAAGCCCAGGCC TGG (reversed) Intronic
900719267 1:4164755-4164777 AGCAGATTGACGCCATGGCCTGG - Intergenic
901109032 1:6780750-6780772 AACACTTAGAAGCTCAGGCCGGG - Intergenic
901327635 1:8378287-8378309 AGCACAGAGAAGCCAGGGCCTGG - Intronic
902531159 1:17091521-17091543 AGCAGATGGAAGCCCAGAGCAGG - Intronic
904481368 1:30795857-30795879 AGCTGAAGGAAGCCAAGGCCTGG + Intergenic
904544255 1:31256086-31256108 AGAAAATAGAAGCCCCAGCCTGG - Intergenic
904703696 1:32374855-32374877 AACAGGTAGGAGCTCAGGCCGGG + Intronic
904976225 1:34458839-34458861 GGGACATAGAAGCCAAGGCCTGG + Intergenic
905389921 1:37629755-37629777 AGCAGCAGGAGGCCCAGGCCTGG + Exonic
906975625 1:50569223-50569245 AGGAGATAGAGGCCCAGGAAAGG - Intronic
907216265 1:52867370-52867392 GGCAGAGAGAAGACCAGGCAGGG - Intronic
907552804 1:55318679-55318701 ATCAGATAGAAACTCAGGCCAGG + Intergenic
908785893 1:67734199-67734221 ACTAGATAGCAGCCCAGACCTGG - Intronic
909278107 1:73714647-73714669 AGGACTTAGGAGCCCAGGCCAGG - Intergenic
909869554 1:80722616-80722638 AGCAGACACACTCCCAGGCCGGG - Intergenic
910393875 1:86772512-86772534 AGGAAAAAGATGCCCAGGCCAGG - Intergenic
911025822 1:93434769-93434791 AGCAGAGAGAAGCCCTGGAGTGG + Intergenic
911071414 1:93834821-93834843 GCCAGATTGAAGTCCAGGCCAGG - Intronic
911273806 1:95836650-95836672 AACAAAAAGAAGCCCAGGACTGG - Intergenic
912806114 1:112758376-112758398 AGCATATAGAAGCTCAGAGCAGG - Intergenic
914902185 1:151716696-151716718 AGCCGGCAGCAGCCCAGGCCCGG - Exonic
915578388 1:156796948-156796970 AGCAGACAGAACCCCATGCTGGG + Intronic
916071341 1:161171849-161171871 AGTAGATAGAGGCCCAGGCCTGG + Exonic
916901413 1:169228202-169228224 AATATATAGAAGCCCAGGCTGGG - Intronic
916986257 1:170194640-170194662 AGTAGAGAAAAGCCCAGGACTGG - Intergenic
917468091 1:175301329-175301351 AGCAAATAAAACCCCAGGCCAGG + Intergenic
918144312 1:181742254-181742276 AGCAGAGAGAGGGCCTGGCCTGG + Intronic
918347355 1:183617479-183617501 GCCAGATTGAAGTCCAGGCCAGG - Intergenic
919664977 1:200283078-200283100 AGTAGAGAGAAGGCCAGGCACGG + Intergenic
920043219 1:203117263-203117285 AGGAGCTGGAAGCCCGGGCCCGG + Intronic
920923642 1:210321085-210321107 AGCAGACAAAAGCCTATGCCAGG + Intergenic
921205382 1:212844387-212844409 GCCAGATTGAAGTCCAGGCCAGG - Intronic
921902187 1:220462987-220463009 AGCAGACAGGAGCCCCGACCGGG + Intergenic
922568529 1:226617856-226617878 CACAGATAAAAGACCAGGCCAGG + Intergenic
923573671 1:235139757-235139779 AGCAGCTAGAAGCTAAGGACAGG + Intronic
923665761 1:235997122-235997144 AGCAGAGAGGAGGCCAGGCATGG - Intronic
923786330 1:237072066-237072088 AGCACATGGATGCCCAGGTCTGG + Intronic
924573367 1:245258077-245258099 AGTTGAGAGCAGCCCAGGCCTGG + Intronic
924947404 1:248855724-248855746 AGCAGACTGAGGCCCTGGCCAGG - Exonic
1063342253 10:5277212-5277234 ATACAATAGAAGCCCAGGCCAGG - Intergenic
1063611502 10:7566479-7566501 AGCACTTAGAAGGCCAGGGCAGG + Intronic
1065583369 10:27193791-27193813 TGGAGATAGAAGTCCAGGGCCGG - Intergenic
1066425390 10:35303485-35303507 AGAGGAAAGAAGCCCAGGCATGG + Intronic
1067016676 10:42761459-42761481 ACAAGAGAGAAGTCCAGGCCAGG - Intergenic
1067022048 10:42809549-42809571 AACAGAAAGAAGGCCAGGCATGG - Intronic
1067047255 10:42991628-42991650 AGCAGATACCAGCCCTGGTCTGG - Intergenic
1067407340 10:46034848-46034870 TGATGATAGAAGCCCAGGCATGG + Intronic
1067541316 10:47156591-47156613 AGCAGACAGAAGTCCCTGCCTGG - Intergenic
1069828335 10:71267916-71267938 AGCAGTTAGGAGGCCAAGCCAGG - Intronic
1069928154 10:71865519-71865541 AGCAGATATAGGCCCATGGCGGG - Intergenic
1070833435 10:79433831-79433853 GGCAGACAGAAGCCCAGGTTGGG + Intronic
1071518623 10:86315386-86315408 AGCAGAGAAAAGCCCAGGGCAGG + Intronic
1071605447 10:86983443-86983465 ACAAGAAAGAAGTCCAGGCCAGG - Intronic
1072250249 10:93576255-93576277 AGCAGAAATAACCCCAAGCCTGG - Intronic
1073081868 10:100865512-100865534 AGCTCACAGAGGCCCAGGCCTGG - Intergenic
1073470996 10:103722005-103722027 AGAATATACAAGCCCTGGCCGGG + Intronic
1074434442 10:113421803-113421825 ATCTGAAAGGAGCCCAGGCCTGG - Intergenic
1074443253 10:113497178-113497200 AGCAGATAGGGGACCAGACCCGG + Intergenic
1075287018 10:121195603-121195625 AGCACATAGATGCCTGGGCCAGG - Intergenic
1075498737 10:122953370-122953392 AGAAGAAAGAAGCCCCGGCCGGG - Intronic
1075558256 10:123448897-123448919 AGCAGATAGACGGCCAGGTGTGG + Intergenic
1075852691 10:125602065-125602087 AGCAGATAGAGGCAGAGCCCAGG - Intronic
1075913571 10:126147268-126147290 AGGAGATAGCAGCAGAGGCCAGG - Intronic
1076161970 10:128251363-128251385 CCCAGATGGAAGCCCAGGCAGGG - Intergenic
1076735180 10:132455789-132455811 AGCAGAGGGAAAGCCAGGCCAGG + Intergenic
1077393497 11:2310347-2310369 AGAAGATAGATGCCCCAGCCGGG + Intronic
1078340277 11:10493572-10493594 AGCAGACAGCAGCCCTGGCTGGG + Intronic
1078789292 11:14526667-14526689 GCCAGATTGAAGTCCAGGCCAGG - Intronic
1079457775 11:20651566-20651588 ATAAGAAAGAAACCCAGGCCAGG - Intronic
1079883947 11:25962646-25962668 AGTAGATAGAAGTCTAGGTCTGG + Intergenic
1080207553 11:29748040-29748062 TGTAGATATAAGCCCATGCCTGG - Intergenic
1080643675 11:34173317-34173339 AGCAGAGAGAGGGTCAGGCCTGG + Intronic
1080643689 11:34173359-34173381 AGCAGAGAGAGGGTCAGGCCTGG + Intronic
1081198513 11:40190221-40190243 AGCAGAAAGAAGGCCTGGCTTGG - Intronic
1081598370 11:44475029-44475051 AGCAGGTAGAAGACCATGTCTGG + Intergenic
1081793965 11:45807198-45807220 AGGGGATAGAAGCACAGGCCTGG - Intronic
1081811847 11:45918566-45918588 AGCCGAGAGAAGCCCGGGCCAGG - Intronic
1083614959 11:64021691-64021713 AGGAGAATGAAGGCCAGGCCAGG - Intronic
1083920384 11:65779097-65779119 AGCAGAGAGTGGCCAAGGCCCGG + Exonic
1084471085 11:69359251-69359273 AGAAGGTAGGAGCCTAGGCCTGG + Intronic
1085518768 11:77126212-77126234 AGCGGACAGTCGCCCAGGCCTGG - Intergenic
1085538596 11:77244326-77244348 AGAAGATACTAGCCCAGGGCTGG - Intronic
1085649729 11:78256928-78256950 TGGAGATAGAAGCTCAGGCCAGG - Intronic
1086502927 11:87471935-87471957 AGCAGATGCAACCACAGGCCAGG + Intergenic
1088982531 11:114876580-114876602 CGAAAATAGAAGTCCAGGCCAGG - Intergenic
1089971629 11:122698306-122698328 AGAAGATAGAAATCCATGCCTGG - Intronic
1089982586 11:122784675-122784697 AACAGTTAGAACCCCAGGGCTGG + Intronic
1090028333 11:123186319-123186341 ACCAGTTATAAGCCCAGGCTGGG + Intronic
1090206148 11:124885460-124885482 TGCAGATAGAAGGCCAGAGCTGG - Intronic
1090383120 11:126340605-126340627 AAAGGATAGAAGCCCAGGCATGG - Intronic
1091053788 11:132399871-132399893 AACACATACAAGCCAAGGCCAGG + Intergenic
1091781085 12:3215022-3215044 AGCAGGTGGGAGCGCAGGCCAGG - Intronic
1092564465 12:9649639-9649661 AGCAGAGAGAAGCCTGAGCCTGG - Intergenic
1093634909 12:21454389-21454411 AGCAGATAGTATCCCAGGTTAGG + Intronic
1095610813 12:44125400-44125422 AGGAAATTGAATCCCAGGCCGGG - Intronic
1095806492 12:46325610-46325632 GCCAGATTGAAGTCCAGGCCAGG + Intergenic
1095945662 12:47751898-47751920 AGCAGGTAGAAGCCTGGGCAGGG - Exonic
1096168633 12:49447530-49447552 AGAAAATAGAAGAACAGGCCGGG - Intronic
1096215465 12:49795688-49795710 AGCAGCTAGAAGCCAAGGGGGGG - Exonic
1096500846 12:52063135-52063157 AGGAGGTGGAAGCCAAGGCCAGG - Intergenic
1096558360 12:52418246-52418268 AGCAGAGAGAAGACCAGGGAAGG + Intergenic
1097806769 12:63973273-63973295 ACCATCTAGAAGCACAGGCCTGG + Intronic
1098253100 12:68589556-68589578 AGTAAAAAGAAGCCAAGGCCGGG + Intergenic
1098653554 12:73003680-73003702 GCCAGATTGAAGTCCAGGCCAGG + Intergenic
1101187805 12:102298340-102298362 AACAAATAAAAGCCCAGGACCGG - Intergenic
1101811588 12:108112463-108112485 AGTGGATAGAAACCCACGCCAGG + Intergenic
1102222002 12:111201128-111201150 AGCAACTAGAAGCCCCGGCCAGG - Intronic
1103573093 12:121857739-121857761 AGCAGGTAGAAGCCGGGGCAAGG - Exonic
1103623054 12:122200539-122200561 AGCAGGTAGCACCACAGGCCAGG - Exonic
1103721595 12:122978371-122978393 GGAAGACTGAAGCCCAGGCCTGG + Intronic
1103926102 12:124424072-124424094 GGCAGATAGCAGCCCAGCCTGGG + Intronic
1104685024 12:130779224-130779246 AAAAGATAGAAGACCAAGCCAGG - Intergenic
1106050549 13:26186317-26186339 AGCAGTTAAAAACCCAGACCGGG + Intronic
1106723432 13:32459646-32459668 AACAAATAAAAGCCCAGGACTGG + Intronic
1108594813 13:51940361-51940383 AGCAGATAGAAGGGCAGGTGCGG + Intronic
1110039344 13:70732751-70732773 AGAAAAAAGAAGCCCAGGCAGGG + Intergenic
1112305826 13:98272742-98272764 AGCTGATAGGAGCTCAAGCCAGG - Intronic
1113150857 13:107262122-107262144 AGCATATGGAAGGCCAGGCATGG + Intronic
1113397611 13:109963270-109963292 ATCAGAAAGAAGCTGAGGCCAGG + Intergenic
1113960427 13:114122810-114122832 AGCAGTGAGATGCACAGGCCTGG - Intronic
1114068759 14:19091310-19091332 ACAAGAGAGAAGTCCAGGCCAGG + Intergenic
1114093502 14:19308695-19308717 ACAAGAGAGAAGTCCAGGCCAGG - Intergenic
1114537758 14:23433646-23433668 AGCGGCTAGAAGCGCAGACCAGG - Exonic
1114596459 14:23916515-23916537 AGCAGTTAAAAGACCAGGCTAGG + Intergenic
1114810838 14:25897036-25897058 AGAAGTTTGAAGCCCTGGCCAGG - Intergenic
1115096962 14:29648952-29648974 TGCAGATAAAAGCCCCAGCCAGG - Intronic
1116702123 14:48257047-48257069 ACCTGATTGAAGCCCGGGCCAGG + Intergenic
1116779954 14:49226154-49226176 AGCACATTGATGCCCAGGACTGG - Intergenic
1117054072 14:51892590-51892612 AAAATAAAGAAGCCCAGGCCTGG - Intronic
1117576736 14:57106288-57106310 AGCAGATTGTATCCCATGCCTGG - Intergenic
1119323466 14:73745101-73745123 AGCAGGCAGGAGCCCAGGGCAGG - Intronic
1119385229 14:74254009-74254031 AGCAGCTAGAAGCCCTAGACTGG - Intronic
1119692722 14:76689983-76690005 CCCAGAAAGAAGCCCAGGGCAGG - Intergenic
1121230723 14:92355656-92355678 AGCAGGCAGCACCCCAGGCCCGG - Intronic
1121589014 14:95085268-95085290 AGCAGAGAGATGTGCAGGCCAGG - Intergenic
1121658047 14:95612777-95612799 AGAAGAAAGAAGGCCAGGCATGG + Intergenic
1121701854 14:95960797-95960819 AGCTGATGGAAGCTGAGGCCTGG + Intergenic
1121897780 14:97664495-97664517 AGCAGATAGAAGCCTGGGATAGG - Intergenic
1122716858 14:103701171-103701193 AGAAGATAGAAGGTCAGGGCTGG - Intronic
1122920059 14:104876361-104876383 AGCTGTTAAAAGGCCAGGCCAGG - Intronic
1123957031 15:25347409-25347431 AACACATAGAAGGCCAGGCATGG + Intronic
1125729647 15:41885968-41885990 AGCGGCTAGAAACCCTGGCCCGG - Exonic
1125884056 15:43215219-43215241 AGGAGAGAGATGCCCAGTCCTGG - Exonic
1126529912 15:49701015-49701037 ACCAGATTGAAGTCCGGGCCAGG + Intergenic
1126535114 15:49752818-49752840 TACAGATACAAACCCAGGCCTGG - Intergenic
1127187643 15:56495751-56495773 AGCAGACAGCAGGACAGGCCGGG + Intergenic
1127499737 15:59544850-59544872 TCCAGAAAGAGGCCCAGGCCTGG - Intergenic
1127681811 15:61305034-61305056 AGCACATAGGAGCCAAGGCAGGG + Intergenic
1127806722 15:62527718-62527740 ACCAGCTAAAAGCCCAGCCCTGG - Intronic
1128391851 15:67187633-67187655 ATCAGAGAGAGGCCAAGGCCTGG + Intronic
1128682775 15:69663658-69663680 TGAAGTCAGAAGCCCAGGCCAGG + Intergenic
1129302399 15:74632984-74633006 AGCAGAGAGCAGCCCAGGCTGGG + Intronic
1130781343 15:87043694-87043716 GGCAGATTGAAGTCCAGGCCAGG - Intergenic
1132555049 16:568661-568683 AGCAGAGAGCAGCCCTGGCTGGG - Exonic
1134065503 16:11225663-11225685 AGCAGACAGAAACCCAGGGCGGG - Intergenic
1134373479 16:13647851-13647873 AGCAGATAGATGCAAAGGCAGGG - Intergenic
1134606049 16:15571960-15571982 TGCAGAAAAAAGCACAGGCCGGG + Intronic
1134747385 16:16598843-16598865 AGCAGGTAGATGTCCATGCCTGG + Intergenic
1134998085 16:18754815-18754837 AGCAGGTAGATGTCCATGCCTGG - Intergenic
1135044766 16:19146190-19146212 AGCTGTTAGAAGCCAGGGCCAGG - Intronic
1135570459 16:23545300-23545322 GGGAGAAACAAGCCCAGGCCTGG + Intronic
1135960539 16:26991327-26991349 ATCAAATAATAGCCCAGGCCCGG + Intergenic
1136052465 16:27661686-27661708 AACATAAAGAAACCCAGGCCGGG - Intronic
1136910437 16:34140863-34140885 CGCAGAAAGAAGAGCAGGCCTGG + Intergenic
1139549261 16:67664444-67664466 AGCAGATGGAAATTCAGGCCTGG - Intronic
1139631601 16:68235084-68235106 GGCAGATAGTCCCCCAGGCCAGG + Intronic
1139676128 16:68525023-68525045 ATAAGAGAGTAGCCCAGGCCGGG + Intergenic
1140339197 16:74140416-74140438 AGAAAATAGAAGTCCATGCCTGG + Intergenic
1140513156 16:75522731-75522753 AGAAAAAAGAAGGCCAGGCCGGG - Intergenic
1140744097 16:77965715-77965737 AAGAGATAGCTGCCCAGGCCAGG + Intronic
1141665990 16:85465370-85465392 CCCAGATGGGAGCCCAGGCCTGG - Intergenic
1142244453 16:88963141-88963163 AGCAGACACAGGCCCAGGGCCGG + Intronic
1143108890 17:4542729-4542751 AGCAGCTGGCAGCCTAGGCCAGG + Exonic
1143181823 17:4988156-4988178 AGCAGAGAGAATACAAGGCCAGG + Intronic
1143536563 17:7543964-7543986 AAGAGAAAGAAGCCCAGGACAGG + Intergenic
1143992453 17:10977761-10977783 AGCAGACATAAGGCCAGGCGTGG - Intergenic
1144029200 17:11304492-11304514 AGCAGAGAGAAGCAAAGGGCGGG + Intronic
1144494095 17:15736179-15736201 CTCAGTGAGAAGCCCAGGCCAGG - Intronic
1144770529 17:17757066-17757088 AGCAGATGGAGGCCCAGGGAGGG + Intronic
1144857446 17:18277584-18277606 AGCAGAAAGAAGGCAAGGCAGGG - Intronic
1144906165 17:18640497-18640519 CTCAGTGAGAAGCCCAGGCCAGG + Intronic
1145854669 17:28142932-28142954 AGTACATAGATGCCCAAGCCTGG - Intronic
1145912956 17:28552776-28552798 AACAGAATGAAGCCCAGGGCAGG - Intronic
1146369801 17:32258482-32258504 AGCAGAGAGAAGACAAAGCCTGG - Intergenic
1146677757 17:34785194-34785216 AGAAGGTTGTAGCCCAGGCCAGG - Intergenic
1146900341 17:36581582-36581604 TGTAGATAGAAGTACAGGCCAGG + Intronic
1147551182 17:41443068-41443090 ACAAGGTAGAAGCCCAAGCCAGG - Intergenic
1147670942 17:42176426-42176448 AGGAGATAGAAGGCCAGGAGAGG + Intronic
1148329841 17:46807190-46807212 AACAGAAAGAAGGCCGGGCCTGG + Intronic
1148537470 17:48452262-48452284 ATAAGATAGAAGGCCAGGCATGG - Intergenic
1152678923 17:81655790-81655812 AGCTGGTAGTAGCCCAGGGCTGG - Intronic
1152800051 17:82326761-82326783 AACAGACAGCAGCCCTGGCCTGG - Intronic
1152821266 17:82439065-82439087 AGCAGTGGGAAGCCCAGGCCAGG + Intronic
1153337120 18:3936293-3936315 AGCTGAGAGAGGCCCAGGCCAGG - Intronic
1153771682 18:8421933-8421955 AGGGGAAAGCAGCCCAGGCCGGG + Intergenic
1154091100 18:11364116-11364138 AGAAGATAGAAGGCCAGGTGCGG - Intergenic
1154175752 18:12086672-12086694 AGCAGATCAGAGCCAAGGCCGGG - Intergenic
1155102764 18:22629232-22629254 AACAGAAGGCAGCCCAGGCCCGG + Intergenic
1155174100 18:23288095-23288117 GCCAGATTGAAGTCCAGGCCAGG - Intronic
1155867603 18:30985027-30985049 AGCAGATGGGAGGCCAGGCATGG - Intergenic
1157823342 18:50790078-50790100 AGCAGAGAAAAGCCAAGGCCAGG + Intergenic
1160382492 18:78471259-78471281 AGCAGAAAGCAGCCCTCGCCAGG + Intergenic
1162135299 19:8551644-8551666 AGGAAACCGAAGCCCAGGCCAGG - Intronic
1162931664 19:13960683-13960705 AGGAGAGGGCAGCCCAGGCCAGG + Intronic
1163703448 19:18798777-18798799 TGCAGACAGGAGCCCAGGCCAGG + Intergenic
1164405500 19:27941867-27941889 AGCAGATTGAAAGACAGGCCAGG + Intergenic
1164620046 19:29689996-29690018 AGGTGAGAGAAGCCCAGGCATGG + Intergenic
1164672088 19:30077997-30078019 TGCAGCTAGGAGCCCAGGCTGGG - Intergenic
1164906040 19:31968947-31968969 AGCAGATAGAGGTCTAGGTCTGG - Intergenic
1165500527 19:36185654-36185676 AGCAGCAAAAAGCCCAGGACAGG - Intronic
1166741625 19:45118103-45118125 GGCAGTTGGAAGCCCAGGCGGGG - Intronic
1167131316 19:47587924-47587946 AGAAAGTAGAAGCCCAGGCCGGG - Intergenic
1167252988 19:48410803-48410825 GGCAGAGAGAGCCCCAGGCCAGG + Intronic
1167781006 19:51598769-51598791 TGCAGTAAGATGCCCAGGCCCGG - Intergenic
1167969034 19:53174646-53174668 AGAAGAAAGAAGGCCAGGCATGG + Intronic
1168258234 19:55178912-55178934 AGCAGAGAGAAAGCCTGGCCAGG - Intronic
925641175 2:5987035-5987057 TGCAGAGAGAAGACCAGGCTTGG - Intergenic
926487364 2:13478450-13478472 AACAGATAGTAGGCCAAGCCTGG + Intergenic
926815306 2:16793817-16793839 GCCAGATTGAAGTCCAGGCCAGG + Intergenic
927494778 2:23545082-23545104 AGATGACAGAGGCCCAGGCCAGG + Intronic
929448748 2:42022085-42022107 AACAGATATATGCCCAGGCTAGG - Intergenic
929588323 2:43129920-43129942 AGCAGATAGCATCCCTGGGCAGG - Intergenic
929865358 2:45712751-45712773 AGCAGATGGAAGCCCAGAGGAGG - Intronic
931224790 2:60320492-60320514 AGGTGGTAGGAGCCCAGGCCAGG + Intergenic
932914204 2:75837490-75837512 ACCAAATAAAAGCCCAGGACCGG + Intergenic
932948399 2:76264504-76264526 AGCAGCTGGCAGCCCAGGCTTGG - Intergenic
933054569 2:77645435-77645457 AGAAAATAGAAGCCTTGGCCAGG - Intergenic
934474739 2:94586684-94586706 AGGAGGTAGAAGCCCAGGCCTGG - Intergenic
935540845 2:104347148-104347170 AGAAGATAGATGCATAGGCCAGG + Intergenic
937045766 2:118850691-118850713 ACTTGATAGATGCCCAGGCCGGG + Intergenic
937310910 2:120902829-120902851 AGCCTAAAGAAGCCCAGGCTTGG - Intronic
937941956 2:127293305-127293327 AGCTGTTGGAAGCCCAGGTCCGG + Intronic
939094813 2:137822416-137822438 GCCAGATTGAAGTCCAGGCCAGG - Intergenic
939460502 2:142491716-142491738 GCCAGATTGAAGTCCAGGCCAGG + Intergenic
939887888 2:147701152-147701174 GGCAGATAGGAGCCCTGTCCAGG + Intergenic
940217107 2:151312884-151312906 GCCAGATTGAAGTCCAGGCCAGG - Intergenic
940341894 2:152590174-152590196 AGCAGCTAGAAGGCCAGACATGG - Intronic
940910625 2:159206482-159206504 AGCAGGTAGAAACCCAGGGGTGG + Intronic
940911876 2:159216475-159216497 GGCAGAAACAACCCCAGGCCAGG - Intronic
941975240 2:171397115-171397137 TGAAGATAGAAGCTGAGGCCAGG - Intronic
942396537 2:175555773-175555795 ATCAGATGGAAGGCCAGGCGCGG - Intergenic
943401069 2:187411678-187411700 AGCAGATAGAAGGATAAGCCAGG + Intronic
946371159 2:219282105-219282127 AGCTGATGGAAGGACAGGCCTGG - Intronic
947452166 2:230218932-230218954 AGCATAAAGAAGGCCAGGCATGG + Intronic
948119086 2:235515409-235515431 AGCAGAGAGAAGAGCAGGGCAGG + Intronic
1168827612 20:824289-824311 AGCAAATAGAAGGCCAGGCATGG + Intergenic
1169029480 20:2396590-2396612 AGCACATACGAGCCCAGGGCTGG + Exonic
1173102145 20:40097163-40097185 GCCAGATTGAAGTCCAGGCCAGG - Intergenic
1173665056 20:44757329-44757351 AGCAGATAGATGCATAAGCCAGG - Intronic
1174048377 20:47749868-47749890 TGAAGAGAGAGGCCCAGGCCTGG - Intronic
1174253801 20:49239039-49239061 AGCAGTCAGAAGCCCAGGTGAGG + Exonic
1175158135 20:56988087-56988109 AGCAGAGATAAGACCAGGCGCGG - Intergenic
1175350231 20:58312778-58312800 AGCAGATAGGCGGCCAGGCACGG - Intronic
1177545992 21:22559938-22559960 AGAAGATAGGAAGCCAGGCCGGG - Intergenic
1178119771 21:29457322-29457344 AGAAGAGAGGAGCCCAGGACAGG - Intronic
1180487230 22:15813870-15813892 ACAAGAGAGAAGTCCAGGCCAGG + Intergenic
1180556657 22:16583777-16583799 GGCAGATACTAGCCCAGGCACGG + Intergenic
1181049846 22:20233306-20233328 AGCAGTGAGAGGGCCAGGCCAGG - Intergenic
1181235187 22:21444284-21444306 GGCAGCTGGAAGCCCAGGCTGGG + Intronic
1181666550 22:24402250-24402272 AGCAGCTAGAGGGCCTGGCCAGG + Intronic
1182064780 22:27422890-27422912 AGCAGACAGAAGCCCAGAGATGG - Intergenic
1182346327 22:29668403-29668425 AGCAGATGAAAGCCCAGGCCAGG + Exonic
1185053940 22:48568226-48568248 AGAAGATGGAGGCGCAGGCCAGG - Intronic
1185329922 22:50247889-50247911 AGGAGACAGAAGCCTGGGCCAGG - Exonic
949462015 3:4303676-4303698 AACAGAAAAAGGCCCAGGCCGGG - Intronic
950091696 3:10300261-10300283 AGAAGGTAGAAGCCCTGCCCAGG - Intronic
951213565 3:20002627-20002649 AGCAAATAGAAGGCCAGGCACGG + Intronic
952894927 3:38072165-38072187 GCCAGATTGAAGTCCAGGCCAGG + Intronic
953032897 3:39189612-39189634 AGCGAAGTGAAGCCCAGGCCAGG - Intronic
953834191 3:46328992-46329014 GCCAGATTGAAGTCCAGGCCAGG + Intergenic
954737687 3:52719990-52720012 AGCAGAAAAAAGTCCAGGCTTGG + Intronic
955235481 3:57135305-57135327 AGGAGGCAGAAGGCCAGGCCAGG + Intronic
956822219 3:72964103-72964125 AGTAAAGAGAAGCCAAGGCCGGG - Intronic
957614464 3:82509336-82509358 AGCAAATTGAAGCCAAGTCCAGG + Intergenic
957705023 3:83770023-83770045 ACCAGACAGAAGCCCCGCCCAGG + Intergenic
958121072 3:89289254-89289276 AGCAGAGAGAAGCTGAGGCTTGG + Intronic
959288115 3:104441796-104441818 GCCAGATTGAAGTCCAGGCCAGG + Intergenic
960989297 3:123300392-123300414 AGCAGAAACATGCCCAGCCCAGG - Intronic
961263788 3:125623720-125623742 AGTAGATGGGAGGCCAGGCCAGG - Intergenic
962801966 3:138898138-138898160 AGTAGAAAGGATCCCAGGCCAGG - Intergenic
963047980 3:141117322-141117344 AGGAAACAGCAGCCCAGGCCTGG - Intronic
964632563 3:158827709-158827731 AGAAGTTCAAAGCCCAGGCCAGG - Intronic
965335390 3:167426805-167426827 GCCAGATTGAAGTCCAGGCCAGG - Intergenic
965626083 3:170685209-170685231 GCCAGATTGAAGTCCAGGCCAGG + Intronic
966287122 3:178311266-178311288 AGCAGAAAGAAGCCCTGGAATGG + Intergenic
966912295 3:184566289-184566311 AGGGGAAAGAAGCCCAGGGCGGG - Intronic
968230419 3:197002388-197002410 AGTAGAGAGAGGCCCCGGCCGGG + Exonic
968985780 4:3873624-3873646 AACACAGAGAAGCCCAGGGCTGG - Intergenic
969666548 4:8560655-8560677 ACCTGAGAGAAGCCCGGGCCCGG - Intronic
970560461 4:17277022-17277044 AGCAGATACCAGCCCACACCCGG + Intergenic
972369797 4:38412316-38412338 AGCTGGCAGGAGCCCAGGCCTGG + Intergenic
973724620 4:53763148-53763170 TGCAGATTGAAGCCCAGGAAGGG - Intronic
973766420 4:54167425-54167447 AGCAGAGAGCAGCCCTCGCCAGG - Intronic
974874664 4:67688272-67688294 AGCAGCTAGAAAACCAAGCCTGG + Intronic
975180017 4:71333883-71333905 TGAAGTTAGAAACCCAGGCCTGG - Intronic
978031754 4:103945181-103945203 GCCAGATTGAAGTCCAGGCCAGG - Intergenic
978552745 4:109945444-109945466 AACAAATAGAAGGCCAGGCATGG + Intronic
978603091 4:110448976-110448998 AGTAAAAAGATGCCCAGGCCAGG - Intronic
978755130 4:112293568-112293590 AGGAAATAGAATCACAGGCCTGG - Intronic
979501804 4:121449051-121449073 AGAAGAAAGAGGGCCAGGCCAGG + Intergenic
984261745 4:177451234-177451256 AGCAGCTGGAATCCCAGGCATGG + Intergenic
984548574 4:181134398-181134420 AGCAGATATAAGGCCAGGCATGG + Intergenic
985200054 4:187475641-187475663 AACACATAGAAGGCCGGGCCCGG + Intergenic
985989227 5:3541734-3541756 ATTAGAAAGATGCCCAGGCCGGG + Intergenic
986817100 5:11424929-11424951 AGCAGAGATGAGCCCAGGGCAGG - Intronic
987930244 5:24392149-24392171 ACCAGATCCAAACCCAGGCCTGG - Intergenic
988098286 5:26645619-26645641 AACAGATAAAACCCCAAGCCAGG - Intergenic
989017173 5:36951250-36951272 AGCAGATCCAACCCCAGGCTAGG - Intronic
989163556 5:38413705-38413727 AGTAGAGAGGAGCCCAGGCAGGG - Intronic
989298825 5:39864154-39864176 AGGAGCTAGAATCCCAGGCAAGG + Intergenic
991489065 5:67165747-67165769 AGCAGCCACAAGCCCCGGCCTGG + Exonic
992081651 5:73239274-73239296 AAGAGATAGAAGCCTAGTCCCGG + Intergenic
992615632 5:78543589-78543611 TGCAGCCAGAAGGCCAGGCCTGG - Intronic
995291851 5:110465877-110465899 AGCAGAAAGAAGCTCATGCATGG - Intronic
995455849 5:112351485-112351507 AACAAAGAAAAGCCCAGGCCTGG + Intronic
996019560 5:118576640-118576662 AGCAGATCAGAGCCCAGGGCAGG - Intergenic
996468276 5:123828753-123828775 AACAGAGAAAAGCCCAGGGCAGG + Intergenic
996738664 5:126778791-126778813 TGCAGATAGTAGACCAGGGCAGG + Intronic
996794057 5:127324983-127325005 AGCAGATATACGAACAGGCCTGG - Intronic
996917900 5:128733164-128733186 ACCAGATTGAAGTCCGGGCCAGG - Intronic
997364912 5:133319481-133319503 AGCAGAGGGAAGAGCAGGCCAGG + Intronic
998394470 5:141809840-141809862 AGTGGCTAGGAGCCCAGGCCTGG - Intergenic
998506679 5:142678089-142678111 AGCAGACAGGAGGCCAGGGCTGG + Intronic
998822310 5:146067834-146067856 AGCACCTAAAAGCTCAGGCCAGG + Intronic
999388160 5:151170409-151170431 AGCAGATAGATCCCCAGGAGAGG + Intergenic
999432556 5:151536700-151536722 AGCATATGGAAGCCTAGCCCAGG - Intronic
999756128 5:154665822-154665844 AGGGGCTAGAAGCCCAGCCCAGG - Intergenic
999796654 5:154995141-154995163 AGAAAACAGAAGCCAAGGCCAGG + Intergenic
1000245638 5:159446636-159446658 AGCAGTGAGCAGCCCAGGCTGGG - Intergenic
1000928836 5:167228323-167228345 AGAAGAAAGAATCTCAGGCCAGG - Intergenic
1001249332 5:170134369-170134391 AGCAGATAGAAGCCAAGCTGTGG - Intergenic
1001919812 5:175590983-175591005 TGCAGTTAGGAGCACAGGCCAGG - Intergenic
1002467316 5:179414047-179414069 GGCACAGAGAAGGCCAGGCCTGG + Intergenic
1003058118 6:2841420-2841442 TGCAGATAGGAGCCGCGGCCTGG + Intronic
1003058610 6:2844364-2844386 AGCAGAGAGCAGCCCACACCAGG - Intergenic
1003429942 6:6029673-6029695 GCCAGATTGAAGTCCAGGCCAGG + Intergenic
1005728355 6:28671488-28671510 TGCAGATAGAAGCCTGGGCACGG + Intergenic
1006074780 6:31524970-31524992 AACAGATAGAGGGCCAGGCACGG + Intergenic
1006635828 6:35460487-35460509 AGCAGATAGATACTCAGGCTTGG + Intronic
1009913318 6:69960924-69960946 AGAAGAAAGCAGCCCTGGCCGGG - Intronic
1010450206 6:75993994-75994016 AGCACACAGCAGCTCAGGCCAGG - Intronic
1014556079 6:122843657-122843679 GCCAGATTGAAGTCCAGGCCAGG - Intergenic
1015544642 6:134349011-134349033 AAAAGATAGAGGCCCAGACCGGG + Intergenic
1017018561 6:150121354-150121376 AACAGAAAGAAGGCCAGGCATGG - Intergenic
1017270082 6:152494309-152494331 GCCAGATTGAAGTCCAGGCCAGG - Intronic
1017467993 6:154712794-154712816 AACAGAAACAAGCCCAAGCCTGG - Intergenic
1017882870 6:158573669-158573691 AGCAGCTAGAAGCGCAGGGCTGG - Intronic
1017908224 6:158771273-158771295 AGCAGATGAAGGCCCAGGCCCGG - Exonic
1018077831 6:160232152-160232174 GCCAGATTGAAGTCCAGGCCAGG - Intronic
1019483660 7:1277681-1277703 GGCAGTTAGAAGCCAAGGTCTGG - Intergenic
1019559379 7:1648378-1648400 AGCAGATAAAACGCCTGGCCAGG - Intergenic
1019871704 7:3769758-3769780 AGCAGAAAGTAAGCCAGGCCTGG - Intronic
1020372021 7:7442744-7442766 AATAGAAAGAAGCCCAGGCGCGG + Intronic
1021172951 7:17417920-17417942 GCCAGATTGAAGTCCAGGCCAGG - Intergenic
1022514435 7:30966276-30966298 AGCAGATGTAAGACCAGGGCTGG - Intronic
1022603553 7:31785338-31785360 AGCAGATGGCAGCCCAGGCTGGG + Intronic
1023823188 7:43991355-43991377 ACCAGATGGAAGTCCAGGCATGG + Intergenic
1025175637 7:56800486-56800508 AGCAAATAGCAGGCCAGGCATGG + Intergenic
1025623046 7:63191833-63191855 AGTAAAAAGATGCCCAGGCCAGG - Intergenic
1025696157 7:63775935-63775957 AGCAAATAGCAGGCCAGGCATGG - Intergenic
1026494818 7:70893115-70893137 GGCAGAGAAGAGCCCAGGCCAGG - Intergenic
1027234784 7:76291855-76291877 AGCAGAGAGATGCCTGGGCCAGG + Intergenic
1029183977 7:98725454-98725476 AGCAGAGAGAAGACCAGGCAAGG - Intergenic
1029317468 7:99727476-99727498 GCCAGACTGAAGCCCAGGCCAGG - Intronic
1029751451 7:102544793-102544815 ACCAGATGGAAGTCCAGGCATGG + Intronic
1029769403 7:102643886-102643908 ACCAGATGGAAGTCCAGGCATGG + Intronic
1031734728 7:125343621-125343643 AGAAGACAGAAGGCCAGGCGCGG - Intergenic
1032178079 7:129649456-129649478 AGCAGAAAGAAAAGCAGGCCAGG - Intronic
1032385417 7:131519402-131519424 GGTAGATAGAGGACCAGGCCTGG - Intronic
1033471981 7:141658534-141658556 GGGAGATAAAAGCCCATGCCTGG + Exonic
1034295602 7:149969387-149969409 AGCAGATAGCAGTCCTGGGCTGG + Intergenic
1034407203 7:150912672-150912694 AGCAGGAAGCAGCTCAGGCCAGG + Intergenic
1034419276 7:150980413-150980435 AACAGAGAGGAGCCCAGGCACGG + Intergenic
1034810459 7:154127518-154127540 AGCAGATAGCAGTCCTGGGCTGG - Intronic
1035015078 7:155758677-155758699 AGCAGAAAGAAGCCCTGCCTGGG - Intronic
1035722092 8:1799546-1799568 AGAAGATAGAAGGCATGGCCGGG - Intergenic
1035835151 8:2742198-2742220 AGTAGATAAAAGCACAGTCCTGG - Intergenic
1037845088 8:22275666-22275688 AGGAGATAGAACCCCTGGCAGGG + Intronic
1037943911 8:22974619-22974641 AGAAGCTATAAGGCCAGGCCAGG + Intronic
1038614262 8:29077990-29078012 AGCAGAGAGGAGGCCAGGCACGG + Intronic
1044132780 8:88546583-88546605 ATCAGATTGAATCCCAAGCCTGG - Intergenic
1047591472 8:126331592-126331614 AGCACATAGCAGCCCAGGAAAGG + Intergenic
1049529927 8:143149064-143149086 AGGGGACAGAAGACCAGGCCTGG + Intergenic
1050391410 9:5147503-5147525 AGTAGCTAGAGGCCCAGGCCTGG + Intronic
1051999515 9:23260189-23260211 AGAAAATATATGCCCAGGCCGGG + Intergenic
1052162767 9:25287493-25287515 AGTAGATAGCATCGCAGGCCTGG + Intergenic
1052215125 9:25957648-25957670 AGGAGAGAGAAGCCCAAGCAGGG + Intergenic
1052855312 9:33403074-33403096 AGGAGGTAGAAGCCCAGGCCTGG + Intergenic
1052937154 9:34102365-34102387 AGCACTTAAAAACCCAGGCCGGG + Intronic
1053461711 9:38276656-38276678 AGCAAAATGAAGCCCAGGACAGG + Intergenic
1053683322 9:40499417-40499439 AGGAGGTAGAAGCCCAGGCCTGG + Intergenic
1053933302 9:43127732-43127754 AGGAGGTAGAAGCCCAGGCCTGG + Intergenic
1054280392 9:63125511-63125533 AGGAGGTAGAAGCCCAGGCCTGG - Intergenic
1054296426 9:63334915-63334937 AGGAGGTAGAAGCCCAGGCCTGG + Intergenic
1054394443 9:64639420-64639442 AGGAGGTAGAAGCCCAGGCCTGG + Intergenic
1054429092 9:65144619-65144641 AGGAGGTAGAAGCCCAGGCCTGG + Intergenic
1054501291 9:65876916-65876938 AGGAGGTAGAAGCCCAGGCCTGG - Intergenic
1054807211 9:69406417-69406439 GCCAGATTGAAGCCCGGGCCAGG + Intergenic
1054936892 9:70697865-70697887 AGGGGATAGTAGCCCAGACCTGG - Intronic
1055554228 9:77459433-77459455 AGCAGACAGGAGGCGAGGCCAGG - Intronic
1056044496 9:82702598-82702620 GCCAGATTGAAGTCCAGGCCAGG + Intergenic
1057027544 9:91746370-91746392 AGCAGAAACCAGGCCAGGCCAGG - Intronic
1057259378 9:93575773-93575795 AGAGGACAGAAGCCCGGGCCGGG - Intergenic
1057784072 9:98073576-98073598 AAAAAAAAGAAGCCCAGGCCAGG - Intronic
1057967215 9:99515975-99515997 AGCTGTGAGAAGCCCAGGCAGGG + Intergenic
1058339213 9:103873540-103873562 AGAAAATAGAAGGCCAGGCGTGG + Intergenic
1059043380 9:110839000-110839022 AGAAAATACATGCCCAGGCCGGG + Intergenic
1059823962 9:118006055-118006077 AGCAGAGGGAAGGCCATGCCAGG - Intergenic
1059824092 9:118007766-118007788 AGCAGAGAGAAGGCCATGCCAGG - Intergenic
1060187937 9:121575214-121575236 AGCAGATAGAAGCCCAGGCCTGG - Intronic
1060409263 9:123389351-123389373 AGCAGAGAAAAGCCCAGCACTGG - Intronic
1060885315 9:127148261-127148283 TGCAGAGAGAATCCCAGGCTGGG - Intronic
1060937894 9:127526607-127526629 AGCAGCCAGAAGGACAGGCCTGG - Intronic
1060967027 9:127717197-127717219 AGTAGACAGAAGCCCAGGGAGGG - Intronic
1061009824 9:127948321-127948343 AGCGGATGGGAGCCCAGTCCCGG - Intronic
1061113275 9:128590936-128590958 AGCAGAGAGAAGGCCAGCCTTGG + Intronic
1061454739 9:130689279-130689301 AGAAAATTGAAGCCCAGGCATGG + Intergenic
1061778759 9:132983766-132983788 TGCAGAGAGAAGCCCATGCCGGG + Intronic
1185493711 X:538442-538464 AGCATCTAGAAGGCCAGGCTTGG - Intergenic
1185960454 X:4542361-4542383 GCCAGATTGAAGTCCAGGCCAGG + Intergenic
1189308383 X:40004264-40004286 ACCAGATGGAAGGCCTGGCCTGG + Intergenic
1190239807 X:48648695-48648717 AACAAAGAGAACCCCAGGCCTGG - Intergenic
1191869670 X:65735379-65735401 AGCAGATGAAGGCACAGGCCCGG + Exonic
1192184297 X:68936287-68936309 AGCTGAGAGAAGCCCAGACTTGG + Intergenic
1192447382 X:71221234-71221256 TGCATATAGAATCCCAGGCTTGG + Intronic
1192585427 X:72314920-72314942 AGCAGAGAGGACCACAGGCCTGG + Intergenic
1193155820 X:78173244-78173266 AGCAGATAGGTGCCCACCCCAGG - Intergenic
1193158153 X:78196593-78196615 AGCAGATAGGTGCCCACCCCAGG + Intergenic
1193235670 X:79104005-79104027 AACAAAAAAAAGCCCAGGCCAGG - Intergenic
1195236826 X:102908354-102908376 AACAGAGAAAAGCCCAGACCTGG + Intergenic
1196654715 X:118205528-118205550 AGCAGATATAAAGCCAGGCATGG - Intergenic
1196773629 X:119319661-119319683 GCCAGATTGAAGTCCAGGCCAGG + Intergenic
1197122345 X:122906960-122906982 GGTAGATGGAAGCCTAGGCCTGG - Intergenic
1197653200 X:129087237-129087259 AGCAGACACATACCCAGGCCAGG + Intergenic
1198882784 X:141299218-141299240 AGCAGATAGGAGCCAGGTCCTGG - Intergenic
1199755394 X:150859847-150859869 AACAGAGAAAAGCCCAGGACAGG + Intronic
1201270752 Y:12251629-12251651 AGCAGAACGAAAACCAGGCCTGG + Intergenic
1201555300 Y:15260384-15260406 AGCAGGGAGAAGCTCAGGCATGG - Intergenic
1201783062 Y:17744374-17744396 ACCAGCCAGGAGCCCAGGCCAGG - Intergenic
1201818491 Y:18161613-18161635 ACCAGCCAGGAGCCCAGGCCAGG + Intergenic