ID: 1060187937

View in Genome Browser
Species Human (GRCh38)
Location 9:121575214-121575236
Sequence AGCAGATAGAAGCCCAGGCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1060187937_1060187946 30 Left 1060187937 9:121575214-121575236 CCAGGCCTGGGCTTCTATCTGCT No data
Right 1060187946 9:121575267-121575289 GTTGATTCTCAGAGCCTCGGAGG No data
1060187937_1060187945 27 Left 1060187937 9:121575214-121575236 CCAGGCCTGGGCTTCTATCTGCT No data
Right 1060187945 9:121575264-121575286 CCAGTTGATTCTCAGAGCCTCGG No data
1060187937_1060187940 4 Left 1060187937 9:121575214-121575236 CCAGGCCTGGGCTTCTATCTGCT No data
Right 1060187940 9:121575241-121575263 CTCCGTGTGACCTGTGAGCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1060187937 Original CRISPR AGCAGATAGAAGCCCAGGCC TGG (reversed) Intronic