ID: 1060187938

View in Genome Browser
Species Human (GRCh38)
Location 9:121575219-121575241
Sequence GGCGCAGCAGATAGAAGCCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 162
Summary {0: 1, 1: 0, 2: 2, 3: 16, 4: 143}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1060187938_1060187948 30 Left 1060187938 9:121575219-121575241 CCTGGGCTTCTATCTGCTGCGCC 0: 1
1: 0
2: 2
3: 16
4: 143
Right 1060187948 9:121575272-121575294 TTCTCAGAGCCTCGGAGGGATGG No data
1060187938_1060187947 26 Left 1060187938 9:121575219-121575241 CCTGGGCTTCTATCTGCTGCGCC 0: 1
1: 0
2: 2
3: 16
4: 143
Right 1060187947 9:121575268-121575290 TTGATTCTCAGAGCCTCGGAGGG No data
1060187938_1060187946 25 Left 1060187938 9:121575219-121575241 CCTGGGCTTCTATCTGCTGCGCC 0: 1
1: 0
2: 2
3: 16
4: 143
Right 1060187946 9:121575267-121575289 GTTGATTCTCAGAGCCTCGGAGG No data
1060187938_1060187945 22 Left 1060187938 9:121575219-121575241 CCTGGGCTTCTATCTGCTGCGCC 0: 1
1: 0
2: 2
3: 16
4: 143
Right 1060187945 9:121575264-121575286 CCAGTTGATTCTCAGAGCCTCGG No data
1060187938_1060187940 -1 Left 1060187938 9:121575219-121575241 CCTGGGCTTCTATCTGCTGCGCC 0: 1
1: 0
2: 2
3: 16
4: 143
Right 1060187940 9:121575241-121575263 CTCCGTGTGACCTGTGAGCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1060187938 Original CRISPR GGCGCAGCAGATAGAAGCCC AGG (reversed) Intronic
900200990 1:1406529-1406551 ACGGCAGCAGATAGTAGCCCTGG + Intronic
900440478 1:2652589-2652611 GGAGCAGCACCCAGAAGCCCAGG + Intronic
901800633 1:11706194-11706216 GGGGCAGCAGAGAGAGGCCTGGG + Intronic
903804783 1:25997678-25997700 GGAGGAGCATAAAGAAGCCCGGG + Intronic
904034454 1:27551329-27551351 GGCCCAGCTGCTAGAGGCCCAGG - Exonic
904808335 1:33147100-33147122 TGCCCAGGAGATAGAAGACCTGG - Exonic
905107895 1:35574853-35574875 GGCGGAGCAGACAGAGACCCTGG + Intronic
906528555 1:46510543-46510565 GGCTCAGCAGCTCGAGGCCCTGG + Exonic
907769294 1:57443996-57444018 GGGGCAGATGATAGAAGGCCTGG - Intronic
908140636 1:61180588-61180610 GGCTCAGCAGACAGAAGTCTTGG + Intronic
910354857 1:86342339-86342361 GGAGCAGAAGAAAGAAGCCCCGG - Intergenic
910729435 1:90376738-90376760 GGCACAGTAGATAAAAGTCCTGG + Intergenic
911025820 1:93434764-93434786 CCCTCAGCAGAGAGAAGCCCTGG + Intergenic
912951475 1:114123518-114123540 GGGGCAGCAGAGAGGAGCCCTGG + Intronic
915129282 1:153685980-153686002 GGAGCAGCAGATGGGGGCCCTGG + Intronic
915142719 1:153777108-153777130 CACACAGCTGATAGAAGCCCTGG - Exonic
915913471 1:159928338-159928360 GGGGCAGCAGGGAGAAGGCCTGG + Exonic
915914489 1:159932687-159932709 AGCTCAGCAGAGACAAGCCCGGG + Intronic
919750194 1:201032997-201033019 GGTGCAGCAGAGTGAGGCCCTGG - Intergenic
924373264 1:243378774-243378796 GGAGCAGCAGAAGGCAGCCCTGG + Exonic
924465006 1:244291702-244291724 GGCACAGCAGCAAGCAGCCCAGG + Intergenic
924947407 1:248855729-248855751 GGCCCAGCAGACTGAGGCCCTGG - Exonic
1062825650 10:566613-566635 GCCCCAGCACACAGAAGCCCAGG + Intronic
1065473793 10:26111801-26111823 GGAGCAGCTAATAGAAGCTCAGG + Intronic
1068714730 10:60175731-60175753 GGCTCAGCAGCCAGGAGCCCGGG + Intronic
1072486833 10:95863873-95863895 GGGGCAGCAGACAGAAGTCCAGG + Intronic
1074145607 10:110714676-110714698 GGAGCAGCAGATAGAGTACCAGG + Intronic
1075558252 10:123448892-123448914 GCCCCAGCAGATAGACGGCCAGG + Intergenic
1077799314 11:5522412-5522434 GGCACAGCAGGTTGAAGCCTGGG + Intronic
1078004505 11:7522529-7522551 GCTACAGAAGATAGAAGCCCAGG - Intronic
1080611993 11:33912585-33912607 GGCCCAGCAGAGAGGAGCCAGGG - Intergenic
1083784394 11:64935415-64935437 GGACCAGCAGATAGAGGACCAGG + Exonic
1083892686 11:65604475-65604497 GGCGGGGCAGATGGAGGCCCAGG + Intronic
1089565890 11:119371486-119371508 GGCACAGGAGATAGAAACGCTGG - Intronic
1091134915 11:133179944-133179966 GGCGCAGGTGATGGAAGCCCTGG + Intronic
1093935259 12:24993948-24993970 GGCCCAGCAGATGGAGGGCCAGG - Exonic
1102077699 12:110073221-110073243 GCTGCAGCAGAGAGAAGCCATGG - Intronic
1104112475 12:125716906-125716928 GGCACAGCAGAGCGAAGGCCAGG + Intergenic
1104659849 12:130603287-130603309 GGCCCAGCTGCTAGAAGCACTGG + Intronic
1105418391 13:20232319-20232341 GGCGCAGCAGGTGGGAGCCGGGG - Exonic
1106398521 13:29404876-29404898 GGCACAGCAGAAGGAAACCCAGG - Intronic
1106788103 13:33127425-33127447 GGCGGAGCAGTGAGAAGCGCTGG + Exonic
1107434315 13:40368739-40368761 CACGCAGCAGCAAGAAGCCCTGG - Intergenic
1107659780 13:42626920-42626942 GGCACAGCACATAGAAGCCAGGG - Intergenic
1108523079 13:51262098-51262120 GAGGCAGCAGTTAGAAGTCCAGG + Intronic
1112339073 13:98537701-98537723 GGGGCAGCAGAAAGGAACCCAGG - Intronic
1113184737 13:107675060-107675082 GACTCAGCAGATAGAGGCCAAGG + Intronic
1113458806 13:110467551-110467573 GGGCCAGCAGATAGAAGCCCAGG - Intronic
1118607316 14:67513997-67514019 GGTACAGCAGAGAGAAACCCAGG + Intronic
1119211195 14:72833422-72833444 GGAGCTCCAGAAAGAAGCCCAGG + Intronic
1122940920 14:104981014-104981036 GGGGCAGCAGGTAGTAGCCCAGG - Intergenic
1123493125 15:20798921-20798943 GGCTCCGCAGATAGAGGACCCGG + Intergenic
1123549631 15:21368023-21368045 GGCTCCGCAGATAGAGGACCCGG + Intergenic
1125862326 15:43010588-43010610 GGAGGAGCAGAAAGAAGTCCAGG + Intronic
1126180479 15:45780551-45780573 GGGGCAGCAGAGGGAAGCTCTGG + Intergenic
1127297769 15:57624883-57624905 GGAGCAGCAGAAAGCAGCCCCGG - Intronic
1129322621 15:74783186-74783208 GGGTGAGCAGTTAGAAGCCCAGG + Intronic
1129468706 15:75738491-75738513 GACGCAGCAGGCAGAGGCCCAGG + Intergenic
1202957962 15_KI270727v1_random:95241-95263 GGCTCCGCAGATAGAGGACCCGG + Intergenic
1132555051 16:568666-568688 GGGACAGCAGAGAGCAGCCCTGG - Exonic
1132606318 16:795248-795270 AGCGCAGCAGCTGGAAGCTCTGG - Exonic
1132696457 16:1204293-1204315 GGCACAGCAGAGGGCAGCCCCGG + Exonic
1132715915 16:1289715-1289737 GGGGCAACAGACACAAGCCCAGG + Intergenic
1132778048 16:1607230-1607252 TGACCACCAGATAGAAGCCCCGG - Exonic
1132933779 16:2471257-2471279 GGCGCAGCAGGCGCAAGCCCGGG - Intergenic
1133775012 16:8889219-8889241 GGTGCAGGAGAAGGAAGCCCCGG - Intergenic
1133924723 16:10183104-10183126 ACCGCAGCAGAAAGACGCCCCGG - Intergenic
1134089851 16:11385554-11385576 GGCGCAGCAGCCAGAGGCCCAGG + Intronic
1137476921 16:48817277-48817299 AGCGCAGCAGATAGAAGCAAAGG - Intergenic
1138329213 16:56199785-56199807 GGCTCAGCAGATAAAAGCTGTGG - Intronic
1139214091 16:65110444-65110466 GGCTGGGCAGTTAGAAGCCCAGG + Intronic
1149416966 17:56469512-56469534 GATGTAGCAGACAGAAGCCCAGG - Intronic
1151679410 17:75615692-75615714 GGCCCAGCAGATGACAGCCCAGG + Intergenic
1151682729 17:75630317-75630339 AGCTCAGCAGGGAGAAGCCCAGG - Intronic
1152258705 17:79255045-79255067 GGCCAAGCAGATACAGGCCCTGG - Intronic
1152358509 17:79818549-79818571 AGCACTGCAGTTAGAAGCCCAGG + Intergenic
1152888871 17:82868397-82868419 GGCGCTGCACACAGAGGCCCGGG - Intronic
1152938663 17:83154474-83154496 GGAGCAGCGGAGAAAAGCCCAGG - Intergenic
1153374385 18:4358848-4358870 GGTGCAGCAGCAGGAAGCCCAGG + Intronic
1157690880 18:49680928-49680950 TGCTCAGCAGATAGAAGCCCAGG + Intergenic
1160178398 18:76614067-76614089 GGCGCGGGAGAGAAAAGCCCAGG + Intergenic
1160379384 18:78439952-78439974 GGCCCAGCAGCTCAAAGCCCAGG - Intergenic
1161233064 19:3185036-3185058 GGTGCAGCAGACAGTAGCCCTGG - Intergenic
1163553864 19:17981915-17981937 GGCCCAGCAGGTAGAGGCGCAGG - Exonic
1166896142 19:46022940-46022962 GGCTCAGGAGACAGAAGACCCGG - Exonic
1168106510 19:54168687-54168709 GGGGCAGCAGAGAGAGGCTCAGG + Intronic
925397829 2:3549368-3549390 GCTGCAGCAGAAAGAATCCCAGG + Intronic
927946046 2:27135814-27135836 GGCGCAGAAGATACCTGCCCGGG - Intergenic
930580354 2:53203770-53203792 AGCGCAGCAGAAAGGAGACCTGG - Intergenic
932402266 2:71489201-71489223 GGGGCAGCAGAAGGAAGCACGGG - Intronic
934706315 2:96484123-96484145 GGAGCACCAGATAGAAGTACAGG - Intergenic
937127265 2:119482598-119482620 TGCACAGCAGAGAGAAGCTCCGG - Intronic
937797985 2:126048090-126048112 GGCCCAGCAGGAAGAAGTCCAGG - Intergenic
939652435 2:144781040-144781062 GACGTATCAGATTGAAGCCCTGG + Intergenic
941509282 2:166385917-166385939 GGGGTAACAGGTAGAAGCCCTGG + Intergenic
942868012 2:180699399-180699421 GCCTCAGCAGAGAGAAGACCTGG + Intergenic
946351974 2:219161020-219161042 GGCGCAGGAGAGGGGAGCCCAGG + Intronic
948264762 2:236628447-236628469 GGCCAAGCAGAGAGAACCCCAGG - Intergenic
949026739 2:241769952-241769974 GGCACAGCAGGAAGTAGCCCAGG - Intergenic
1172082094 20:32350106-32350128 GCCCTAGCAGATAGAAGCCTGGG - Intergenic
1173931861 20:46827536-46827558 GGGGCTGCAGATTGAAGTCCTGG - Intergenic
1174253800 20:49239034-49239056 GATGCAGCAGTCAGAAGCCCAGG + Exonic
1177690538 21:24500650-24500672 GGAGCAGCAGACATCAGCCCTGG + Intergenic
1179818952 21:43925360-43925382 TGGGCAGCAGATAAAAGCCAGGG + Exonic
1179902106 21:44399704-44399726 GGAGCGGCAGGCAGAAGCCCAGG + Intronic
1179909829 21:44441868-44441890 GGCTCAGGAGAGAGAAGCCCTGG - Exonic
1180177257 21:46096901-46096923 GGAGCAGCAGGCAGGAGCCCTGG + Intergenic
1180661773 22:17474005-17474027 GGCACAGTAAATACAAGCCCTGG - Intronic
1182848829 22:33453996-33454018 GGCAAGGCAGAGAGAAGCCCAGG + Intronic
1185280789 22:49969027-49969049 GGAGCAGCAGAGTGCAGCCCAGG - Intergenic
1185294181 22:50045301-50045323 GGAGCAGCAGAAGCAAGCCCAGG - Exonic
949410679 3:3760780-3760802 GGTGCAGAAGATAGAAACACAGG - Intronic
949786855 3:7751417-7751439 GGATCACCAGATAGAAGCACAGG - Intergenic
950581368 3:13864394-13864416 GGCGACGCAGACAGGAGCCCTGG - Intronic
954257717 3:49417999-49418021 GCCACAGCCCATAGAAGCCCTGG + Intronic
954746577 3:52790863-52790885 TGTCCAGCACATAGAAGCCCAGG - Exonic
955790858 3:62587581-62587603 GCAGGAGCAGACAGAAGCCCAGG - Intronic
960828540 3:121818512-121818534 GGCCCAGCAGCTAGAAGTCAAGG + Intronic
960897064 3:122516037-122516059 GATGCAGCAGAGAGAAGTCCAGG - Intergenic
961781795 3:129324903-129324925 GGCTCAGCAGGGAGAAGGCCAGG + Intergenic
961827371 3:129606186-129606208 GCCGCAGCTGGCAGAAGCCCTGG + Exonic
961907370 3:130276796-130276818 GGGGCAGCAGATGGAAGAGCAGG - Intergenic
967928679 3:194673941-194673963 GGTGCAGCACACAGAAACCCTGG - Intergenic
968893456 4:3385037-3385059 GGGGCAGCAGCTGGAAGCCCTGG + Intronic
968948477 4:3678009-3678031 GGAGCAGCAGAGTGAAGCCCAGG + Intergenic
969584730 4:8085132-8085154 GGGGCAGCAGAGGGAAGCTCAGG + Intronic
969867594 4:10085786-10085808 GGAGCAGCAGGTATCAGCCCAGG - Intronic
973724622 4:53763153-53763175 GGCACTGCAGATTGAAGCCCAGG - Intronic
980967902 4:139541065-139541087 GGCACAGGAGAAAGAAGCCGTGG + Intronic
981060849 4:140423651-140423673 TTCCCAGCAGATAAAAGCCCAGG - Intronic
983577138 4:169271403-169271425 GGGGAAGCAGGAAGAAGCCCCGG + Intergenic
985489520 5:171246-171268 GCCGCAGCAGGTAGGAGGCCAGG - Exonic
995524017 5:113036385-113036407 GGCTCTGCAGACAGAATCCCAGG - Intronic
998146997 5:139734641-139734663 GGGGCAGCAGAGAGAAGTCAGGG + Intergenic
999275540 5:150327561-150327583 GTCGCTGCAGATGCAAGCCCTGG + Intronic
1002762630 6:213929-213951 GGCTCAGCAGAAAGAAGACAAGG + Intergenic
1006635827 6:35460482-35460504 GGAGCAGCAGATAGATACTCAGG + Intronic
1014487418 6:122016646-122016668 GGAGAAACAGAGAGAAGCCCAGG + Intergenic
1015939367 6:138432686-138432708 GGCACAGCAGCTCGGAGCCCTGG - Exonic
1017908225 6:158771278-158771300 GGTGCAGCAGATGAAGGCCCAGG - Exonic
1019028986 6:168994455-168994477 CACACAGCAGCTAGAAGCCCAGG - Intergenic
1022603551 7:31785333-31785355 GGCTGAGCAGATGGCAGCCCAGG + Intronic
1022789429 7:33672318-33672340 GGCTCTGCAGACAGAAGCCCTGG - Intergenic
1023912410 7:44565443-44565465 GGACCAGCAGATAGCTGCCCCGG + Exonic
1031816147 7:126438689-126438711 GGCTGACCAGATTGAAGCCCTGG - Exonic
1034942146 7:155237565-155237587 TGGGCAGCAGAGAGAAGCTCGGG - Intergenic
1038698485 8:29827612-29827634 GACCCAGCAGACAGAAGCCAGGG + Intergenic
1039431494 8:37528640-37528662 GGAGCAGCAGAGAGATGGCCTGG - Intergenic
1048278923 8:133090283-133090305 GGAGAAGCAGAGAGAAGCCCTGG + Intronic
1049770652 8:144379418-144379440 TGCACAGCAGGCAGAAGCCCTGG + Exonic
1052816495 9:33106307-33106329 GGCCCAGCTGAAAGAAGCCTGGG + Intronic
1060187938 9:121575219-121575241 GGCGCAGCAGATAGAAGCCCAGG - Intronic
1060967030 9:127717202-127717224 GGAGGAGTAGACAGAAGCCCAGG - Intronic
1061297112 9:129682698-129682720 GGCACAGCAGACAAAAGCCTGGG + Intronic
1061583779 9:131553977-131553999 GGCCCAGCAGCTTGAAGCCAGGG - Intergenic
1061667072 9:132166791-132166813 GGCGCGGCCCAGAGAAGCCCTGG - Exonic
1061909549 9:133715481-133715503 GGAGAAGCAGATAGAGCCCCAGG - Intronic
1062081394 9:134625719-134625741 AGCGCAGCACAGAGAAGCCACGG - Intergenic
1062613084 9:137383690-137383712 GGCGGAGCAGGTAGAGGCTCAGG - Intronic
1062721186 9:138045018-138045040 GGAGCAGGTGATAGAAGGCCAGG + Intronic
1190453698 X:50605575-50605597 GAGGCAGCAGTTACAAGCCCTGG - Intronic
1200043576 X:153387815-153387837 GGGGCAGCAGATGAAGGCCCCGG + Intergenic