ID: 1060187938

View in Genome Browser
Species Human (GRCh38)
Location 9:121575219-121575241
Sequence GGCGCAGCAGATAGAAGCCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 162
Summary {0: 1, 1: 0, 2: 2, 3: 16, 4: 143}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1060187938_1060187946 25 Left 1060187938 9:121575219-121575241 CCTGGGCTTCTATCTGCTGCGCC 0: 1
1: 0
2: 2
3: 16
4: 143
Right 1060187946 9:121575267-121575289 GTTGATTCTCAGAGCCTCGGAGG No data
1060187938_1060187945 22 Left 1060187938 9:121575219-121575241 CCTGGGCTTCTATCTGCTGCGCC 0: 1
1: 0
2: 2
3: 16
4: 143
Right 1060187945 9:121575264-121575286 CCAGTTGATTCTCAGAGCCTCGG No data
1060187938_1060187940 -1 Left 1060187938 9:121575219-121575241 CCTGGGCTTCTATCTGCTGCGCC 0: 1
1: 0
2: 2
3: 16
4: 143
Right 1060187940 9:121575241-121575263 CTCCGTGTGACCTGTGAGCCAGG No data
1060187938_1060187947 26 Left 1060187938 9:121575219-121575241 CCTGGGCTTCTATCTGCTGCGCC 0: 1
1: 0
2: 2
3: 16
4: 143
Right 1060187947 9:121575268-121575290 TTGATTCTCAGAGCCTCGGAGGG No data
1060187938_1060187948 30 Left 1060187938 9:121575219-121575241 CCTGGGCTTCTATCTGCTGCGCC 0: 1
1: 0
2: 2
3: 16
4: 143
Right 1060187948 9:121575272-121575294 TTCTCAGAGCCTCGGAGGGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1060187938 Original CRISPR GGCGCAGCAGATAGAAGCCC AGG (reversed) Intronic