ID: 1060187940

View in Genome Browser
Species Human (GRCh38)
Location 9:121575241-121575263
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1060187927_1060187940 30 Left 1060187927 9:121575188-121575210 CCCCTCCTGAACTGTACTTAACA No data
Right 1060187940 9:121575241-121575263 CTCCGTGTGACCTGTGAGCCAGG No data
1060187935_1060187940 6 Left 1060187935 9:121575212-121575234 CCCCAGGCCTGGGCTTCTATCTG No data
Right 1060187940 9:121575241-121575263 CTCCGTGTGACCTGTGAGCCAGG No data
1060187936_1060187940 5 Left 1060187936 9:121575213-121575235 CCCAGGCCTGGGCTTCTATCTGC No data
Right 1060187940 9:121575241-121575263 CTCCGTGTGACCTGTGAGCCAGG No data
1060187930_1060187940 25 Left 1060187930 9:121575193-121575215 CCTGAACTGTACTTAACACCCCC No data
Right 1060187940 9:121575241-121575263 CTCCGTGTGACCTGTGAGCCAGG No data
1060187934_1060187940 7 Left 1060187934 9:121575211-121575233 CCCCCAGGCCTGGGCTTCTATCT No data
Right 1060187940 9:121575241-121575263 CTCCGTGTGACCTGTGAGCCAGG No data
1060187938_1060187940 -1 Left 1060187938 9:121575219-121575241 CCTGGGCTTCTATCTGCTGCGCC 0: 1
1: 0
2: 2
3: 16
4: 143
Right 1060187940 9:121575241-121575263 CTCCGTGTGACCTGTGAGCCAGG No data
1060187929_1060187940 28 Left 1060187929 9:121575190-121575212 CCTCCTGAACTGTACTTAACACC No data
Right 1060187940 9:121575241-121575263 CTCCGTGTGACCTGTGAGCCAGG No data
1060187937_1060187940 4 Left 1060187937 9:121575214-121575236 CCAGGCCTGGGCTTCTATCTGCT No data
Right 1060187940 9:121575241-121575263 CTCCGTGTGACCTGTGAGCCAGG No data
1060187928_1060187940 29 Left 1060187928 9:121575189-121575211 CCCTCCTGAACTGTACTTAACAC No data
Right 1060187940 9:121575241-121575263 CTCCGTGTGACCTGTGAGCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type