ID: 1060187940

View in Genome Browser
Species Human (GRCh38)
Location 9:121575241-121575263
Sequence CTCCGTGTGACCTGTGAGCC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1060187928_1060187940 29 Left 1060187928 9:121575189-121575211 CCCTCCTGAACTGTACTTAACAC 0: 1
1: 0
2: 3
3: 14
4: 127
Right 1060187940 9:121575241-121575263 CTCCGTGTGACCTGTGAGCCAGG No data
1060187930_1060187940 25 Left 1060187930 9:121575193-121575215 CCTGAACTGTACTTAACACCCCC 0: 1
1: 0
2: 0
3: 3
4: 62
Right 1060187940 9:121575241-121575263 CTCCGTGTGACCTGTGAGCCAGG No data
1060187929_1060187940 28 Left 1060187929 9:121575190-121575212 CCTCCTGAACTGTACTTAACACC 0: 1
1: 0
2: 1
3: 8
4: 89
Right 1060187940 9:121575241-121575263 CTCCGTGTGACCTGTGAGCCAGG No data
1060187927_1060187940 30 Left 1060187927 9:121575188-121575210 CCCCTCCTGAACTGTACTTAACA 0: 1
1: 0
2: 2
3: 7
4: 114
Right 1060187940 9:121575241-121575263 CTCCGTGTGACCTGTGAGCCAGG No data
1060187936_1060187940 5 Left 1060187936 9:121575213-121575235 CCCAGGCCTGGGCTTCTATCTGC 0: 1
1: 0
2: 5
3: 32
4: 287
Right 1060187940 9:121575241-121575263 CTCCGTGTGACCTGTGAGCCAGG No data
1060187935_1060187940 6 Left 1060187935 9:121575212-121575234 CCCCAGGCCTGGGCTTCTATCTG 0: 1
1: 0
2: 0
3: 37
4: 309
Right 1060187940 9:121575241-121575263 CTCCGTGTGACCTGTGAGCCAGG No data
1060187934_1060187940 7 Left 1060187934 9:121575211-121575233 CCCCCAGGCCTGGGCTTCTATCT 0: 1
1: 0
2: 7
3: 89
4: 894
Right 1060187940 9:121575241-121575263 CTCCGTGTGACCTGTGAGCCAGG No data
1060187937_1060187940 4 Left 1060187937 9:121575214-121575236 CCAGGCCTGGGCTTCTATCTGCT 0: 1
1: 0
2: 11
3: 27
4: 401
Right 1060187940 9:121575241-121575263 CTCCGTGTGACCTGTGAGCCAGG No data
1060187938_1060187940 -1 Left 1060187938 9:121575219-121575241 CCTGGGCTTCTATCTGCTGCGCC 0: 1
1: 0
2: 2
3: 16
4: 143
Right 1060187940 9:121575241-121575263 CTCCGTGTGACCTGTGAGCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1060187940 Original CRISPR CTCCGTGTGACCTGTGAGCC AGG Intronic
No off target data available for this crispr