ID: 1060187942

View in Genome Browser
Species Human (GRCh38)
Location 9:121575251-121575273
Sequence AATCAACTGGCCTGGCTCAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1060187942_1060187950 0 Left 1060187942 9:121575251-121575273 CCTGTGAGCCAGGCCAGTTGATT No data
Right 1060187950 9:121575274-121575296 CTCAGAGCCTCGGAGGGATGGGG No data
1060187942_1060187953 23 Left 1060187942 9:121575251-121575273 CCTGTGAGCCAGGCCAGTTGATT No data
Right 1060187953 9:121575297-121575319 ACAGCAGCAGCCACCGCGCAGGG No data
1060187942_1060187946 -7 Left 1060187942 9:121575251-121575273 CCTGTGAGCCAGGCCAGTTGATT No data
Right 1060187946 9:121575267-121575289 GTTGATTCTCAGAGCCTCGGAGG No data
1060187942_1060187945 -10 Left 1060187942 9:121575251-121575273 CCTGTGAGCCAGGCCAGTTGATT No data
Right 1060187945 9:121575264-121575286 CCAGTTGATTCTCAGAGCCTCGG No data
1060187942_1060187952 22 Left 1060187942 9:121575251-121575273 CCTGTGAGCCAGGCCAGTTGATT No data
Right 1060187952 9:121575296-121575318 GACAGCAGCAGCCACCGCGCAGG No data
1060187942_1060187949 -1 Left 1060187942 9:121575251-121575273 CCTGTGAGCCAGGCCAGTTGATT No data
Right 1060187949 9:121575273-121575295 TCTCAGAGCCTCGGAGGGATGGG No data
1060187942_1060187947 -6 Left 1060187942 9:121575251-121575273 CCTGTGAGCCAGGCCAGTTGATT No data
Right 1060187947 9:121575268-121575290 TTGATTCTCAGAGCCTCGGAGGG No data
1060187942_1060187948 -2 Left 1060187942 9:121575251-121575273 CCTGTGAGCCAGGCCAGTTGATT No data
Right 1060187948 9:121575272-121575294 TTCTCAGAGCCTCGGAGGGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1060187942 Original CRISPR AATCAACTGGCCTGGCTCAC AGG (reversed) Intronic