ID: 1060187946

View in Genome Browser
Species Human (GRCh38)
Location 9:121575267-121575289
Sequence GTTGATTCTCAGAGCCTCGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1060187939_1060187946 4 Left 1060187939 9:121575240-121575262 CCTCCGTGTGACCTGTGAGCCAG No data
Right 1060187946 9:121575267-121575289 GTTGATTCTCAGAGCCTCGGAGG No data
1060187938_1060187946 25 Left 1060187938 9:121575219-121575241 CCTGGGCTTCTATCTGCTGCGCC 0: 1
1: 0
2: 2
3: 16
4: 143
Right 1060187946 9:121575267-121575289 GTTGATTCTCAGAGCCTCGGAGG No data
1060187941_1060187946 1 Left 1060187941 9:121575243-121575265 CCGTGTGACCTGTGAGCCAGGCC No data
Right 1060187946 9:121575267-121575289 GTTGATTCTCAGAGCCTCGGAGG No data
1060187937_1060187946 30 Left 1060187937 9:121575214-121575236 CCAGGCCTGGGCTTCTATCTGCT No data
Right 1060187946 9:121575267-121575289 GTTGATTCTCAGAGCCTCGGAGG No data
1060187942_1060187946 -7 Left 1060187942 9:121575251-121575273 CCTGTGAGCCAGGCCAGTTGATT No data
Right 1060187946 9:121575267-121575289 GTTGATTCTCAGAGCCTCGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1060187946 Original CRISPR GTTGATTCTCAGAGCCTCGG AGG Intronic