ID: 1060187947

View in Genome Browser
Species Human (GRCh38)
Location 9:121575268-121575290
Sequence TTGATTCTCAGAGCCTCGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1060187939_1060187947 5 Left 1060187939 9:121575240-121575262 CCTCCGTGTGACCTGTGAGCCAG No data
Right 1060187947 9:121575268-121575290 TTGATTCTCAGAGCCTCGGAGGG No data
1060187942_1060187947 -6 Left 1060187942 9:121575251-121575273 CCTGTGAGCCAGGCCAGTTGATT No data
Right 1060187947 9:121575268-121575290 TTGATTCTCAGAGCCTCGGAGGG No data
1060187941_1060187947 2 Left 1060187941 9:121575243-121575265 CCGTGTGACCTGTGAGCCAGGCC No data
Right 1060187947 9:121575268-121575290 TTGATTCTCAGAGCCTCGGAGGG No data
1060187938_1060187947 26 Left 1060187938 9:121575219-121575241 CCTGGGCTTCTATCTGCTGCGCC 0: 1
1: 0
2: 2
3: 16
4: 143
Right 1060187947 9:121575268-121575290 TTGATTCTCAGAGCCTCGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1060187947 Original CRISPR TTGATTCTCAGAGCCTCGGA GGG Intronic