ID: 1060189336

View in Genome Browser
Species Human (GRCh38)
Location 9:121582220-121582242
Sequence AAAGCTTGCTCTCCCCCAGC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 138
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 129}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1060189336_1060189339 4 Left 1060189336 9:121582220-121582242 CCGGCTGGGGGAGAGCAAGCTTT 0: 1
1: 0
2: 0
3: 8
4: 129
Right 1060189339 9:121582247-121582269 TTTTCCTGACTCGTGGTCCTGGG No data
1060189336_1060189337 -3 Left 1060189336 9:121582220-121582242 CCGGCTGGGGGAGAGCAAGCTTT 0: 1
1: 0
2: 0
3: 8
4: 129
Right 1060189337 9:121582240-121582262 TTTGAACTTTTCCTGACTCGTGG No data
1060189336_1060189344 19 Left 1060189336 9:121582220-121582242 CCGGCTGGGGGAGAGCAAGCTTT 0: 1
1: 0
2: 0
3: 8
4: 129
Right 1060189344 9:121582262-121582284 GTCCTGGGGGTGAAGAGGTCAGG No data
1060189336_1060189343 14 Left 1060189336 9:121582220-121582242 CCGGCTGGGGGAGAGCAAGCTTT 0: 1
1: 0
2: 0
3: 8
4: 129
Right 1060189343 9:121582257-121582279 TCGTGGTCCTGGGGGTGAAGAGG No data
1060189336_1060189338 3 Left 1060189336 9:121582220-121582242 CCGGCTGGGGGAGAGCAAGCTTT 0: 1
1: 0
2: 0
3: 8
4: 129
Right 1060189338 9:121582246-121582268 CTTTTCCTGACTCGTGGTCCTGG No data
1060189336_1060189340 5 Left 1060189336 9:121582220-121582242 CCGGCTGGGGGAGAGCAAGCTTT 0: 1
1: 0
2: 0
3: 8
4: 129
Right 1060189340 9:121582248-121582270 TTTCCTGACTCGTGGTCCTGGGG No data
1060189336_1060189345 20 Left 1060189336 9:121582220-121582242 CCGGCTGGGGGAGAGCAAGCTTT 0: 1
1: 0
2: 0
3: 8
4: 129
Right 1060189345 9:121582263-121582285 TCCTGGGGGTGAAGAGGTCAGGG No data
1060189336_1060189341 6 Left 1060189336 9:121582220-121582242 CCGGCTGGGGGAGAGCAAGCTTT 0: 1
1: 0
2: 0
3: 8
4: 129
Right 1060189341 9:121582249-121582271 TTCCTGACTCGTGGTCCTGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1060189336 Original CRISPR AAAGCTTGCTCTCCCCCAGC CGG (reversed) Intronic
900299058 1:1967665-1967687 AAGGCTTTCTCTTTCCCAGCAGG + Intronic
900604261 1:3516812-3516834 AAGGCTGGCTCTGCCCCAGGAGG - Intronic
903325012 1:22564380-22564402 GAAGCTGCCTCTCCTCCAGCTGG - Intronic
904067583 1:27765934-27765956 ACAGCTTGCTCTCTCCGATCTGG - Intergenic
904545214 1:31265060-31265082 AAATCTTGCCAACCCCCAGCAGG + Intronic
904746692 1:32715848-32715870 TGAGCTGGATCTCCCCCAGCAGG + Intergenic
906065006 1:42974542-42974564 AAAGCCTGCTGTTGCCCAGCTGG + Intergenic
911364459 1:96919880-96919902 CGAGCTTGCTCTTCCCCTGCAGG - Intergenic
917621695 1:176802541-176802563 AAAGCTTCCTCTCTCCTACCTGG - Intronic
918943154 1:191027159-191027181 AAACCTTGCTTTTCCCCTGCTGG + Intergenic
923124027 1:231020108-231020130 CAAGGTTGGTCTCCGCCAGCTGG - Exonic
1065154470 10:22855258-22855280 AAACTTTGCTCTTCACCAGCGGG + Intergenic
1069045781 10:63741758-63741780 AAGGGGTGCTCTGCCCCAGCAGG - Intergenic
1072829663 10:98644377-98644399 ATAGCATGCTCTCCTCCAGAGGG - Intronic
1073488539 10:103837505-103837527 GAAGCTTGCTCTGCCCAAGTGGG - Intronic
1076311007 10:129507480-129507502 AAAGCCAGATCTCCTCCAGCAGG - Intronic
1076540335 10:131210403-131210425 AGAGCTGGCTCTCTTCCAGCAGG - Intronic
1076627315 10:131829914-131829936 AAGCCCTGCTCTCCCCCAGATGG + Intergenic
1080871644 11:36241769-36241791 TAAGCTAGCCCTCCTCCAGCAGG - Intergenic
1080883093 11:36340918-36340940 AAAGCTCTCTCTACCACAGCTGG - Intronic
1081679838 11:44994469-44994491 AAATATTGTTCTCTCCCAGCTGG - Intergenic
1082006580 11:47422689-47422711 AAAGCTGGCTGGCCCCCAGCTGG - Exonic
1082797110 11:57386280-57386302 AAAGCTCCCTCACCTCCAGCTGG + Intergenic
1083329147 11:61889353-61889375 AAAGCTTTCTGTATCCCAGCCGG + Intronic
1088683897 11:112268911-112268933 AAACCTTCCTCTTCCGCAGCTGG - Intronic
1089528337 11:119111142-119111164 AGGGCTTGCTCTGCCCCAGGAGG + Exonic
1089602141 11:119622838-119622860 TGGGTTTGCTCTCCCCCAGCTGG + Intergenic
1090043037 11:123307366-123307388 AAGGCTTCCTTTACCCCAGCAGG + Intergenic
1090893230 11:130946148-130946170 ACAGGATGCTCTCCCACAGCAGG - Intergenic
1097041763 12:56160221-56160243 AATGCTTTCTTTCCCCCTGCAGG + Exonic
1101722266 12:107360339-107360361 AACTCTTGCTGTCCCCCAGATGG - Intronic
1102764911 12:115423855-115423877 TAAGCTTCCTCTCTCCCAGGGGG - Intergenic
1104810877 12:131619779-131619801 AAAGCCTGCTCTCCTGCTGCAGG + Intergenic
1108574036 13:51776677-51776699 GGAGCCTGTTCTCCCCCAGCGGG - Intronic
1115054011 14:29100136-29100158 AAATTTTGCTCTTCCCTAGCTGG - Intergenic
1121312311 14:92941782-92941804 GAAGCTTGCTGTGCCTCAGCAGG + Exonic
1121544488 14:94753431-94753453 AAAGTCTGCTCTTCCCCATCCGG - Intergenic
1122000841 14:98651192-98651214 AAACCTTGCTTGCCCACAGCAGG - Intergenic
1122747287 14:103906056-103906078 AGAGCTCGCCCTCCCCCTGCAGG - Intergenic
1122795121 14:104202169-104202191 ACAGCTGGCCCTCACCCAGCGGG + Intergenic
1124915770 15:33971881-33971903 AAAGATTGTTCTCTCTCAGCAGG - Intronic
1127600078 15:60526649-60526671 ACAGCTTGTCCTCCCCCAGGTGG + Intronic
1127779848 15:62302550-62302572 AAAGCTTCCCACCCCCCAGCAGG + Intergenic
1129978770 15:79847074-79847096 AGCGTTTGCTCTCCCCCTGCTGG - Intronic
1130161470 15:81405257-81405279 AAAGACTGCCCTCCCCAAGCAGG + Intergenic
1130986849 15:88849847-88849869 AGAGCTGGCTCTGCCCCAGAGGG - Intronic
1131540892 15:93274387-93274409 GTAGCTTGCCCTCCCCCAGCTGG - Intergenic
1133678279 16:8096492-8096514 AGAGCCAGCTCTCCTCCAGCAGG + Intergenic
1137401414 16:48156759-48156781 AGAGTTTGCTCCCTCCCAGCCGG - Intergenic
1137769592 16:51005314-51005336 AATGGTTTCTCTTCCCCAGCTGG + Intergenic
1138747973 16:59385735-59385757 ACAGCTGGCTCTCCAGCAGCAGG - Intergenic
1141029243 16:80573471-80573493 CCAGCTGGCTCTCCCCCAGCAGG - Intergenic
1141220560 16:82065567-82065589 AACACTTGGTCTCACCCAGCAGG + Intronic
1148678356 17:49458242-49458264 GCAGCTTGCTCTCCCCAGGCAGG + Intronic
1149403658 17:56324917-56324939 ATAGCTCGCTCACCCCCAACAGG - Intronic
1152108917 17:78346364-78346386 AAAGAGTTCTCTCGCCCAGCGGG - Intergenic
1152585704 17:81188563-81188585 GAGGCTTGCTTTCCCCCAGGAGG - Intergenic
1153236990 18:2997654-2997676 AGAGCCTGCTCTCCCCCCACAGG - Intronic
1154009172 18:10560634-10560656 TAAGCTTGCTCTGCGCCACCTGG - Intergenic
1155007406 18:21741220-21741242 AAACCACGCTCTCCCCCGGCCGG - Intronic
1155256537 18:24002680-24002702 AGAACTTGCTCTCCCTCTGCAGG + Intronic
1160156331 18:76436654-76436676 AAAGGTTGCCCACACCCAGCAGG + Intronic
1161765477 19:6205525-6205547 GAACCTTGCACTCACCCAGCAGG + Intergenic
1166419787 19:42627468-42627490 GATGCTTTCTCTCCCCCTGCAGG + Intronic
1168181785 19:54666675-54666697 ACCCCTTGCTCTACCCCAGCAGG + Exonic
927349715 2:22094729-22094751 CCAGCTTGCTCTCCCTCAACTGG + Intergenic
932392641 2:71410768-71410790 AGAGCTTGCTCTCTTCCATCAGG - Intronic
935585913 2:104800206-104800228 AACCCTTGCTCTACCCTAGCAGG - Intergenic
935697112 2:105779631-105779653 AGAGCTTGCTCTCCGCCCACGGG + Intronic
935763430 2:106342447-106342469 AAAGCCAGAGCTCCCCCAGCCGG - Intergenic
936539297 2:113337051-113337073 AAATCTGCCTCTCCCCCAGGGGG - Intergenic
940144244 2:150528961-150528983 AGAGCTTCCTCTCCCCTATCTGG + Intronic
943989761 2:194672935-194672957 ACAGCTTGCGCTCCACCAGAGGG + Intergenic
947169996 2:227301128-227301150 AGAGTTTGCTCTCTACCAGCTGG + Intronic
947448283 2:230181499-230181521 GAAGCATTCTCTCTCCCAGCAGG - Intronic
1171252548 20:23660333-23660355 AAAGTGGCCTCTCCCCCAGCTGG - Intergenic
1171278619 20:23878919-23878941 CAGGCATGCTCTACCCCAGCAGG + Intronic
1174515159 20:51086234-51086256 AAAGCTTGCTTTATCCCAGCTGG + Intergenic
1176146247 20:63566783-63566805 AGAGCTCCCCCTCCCCCAGCAGG + Intronic
1176164479 20:63665517-63665539 AAACCTGGCTCTCCCTTAGCTGG + Intronic
1177213949 21:18105296-18105318 ACAGCTTGCTCTGCTACAGCTGG - Intronic
1178269685 21:31178242-31178264 AATGCCTTCTCTCCACCAGCAGG + Intronic
1178922827 21:36750174-36750196 AATGCTTCCTCTTCCCCTGCCGG - Intergenic
1182522652 22:30893025-30893047 ACAGCTTGCCCTGCCTCAGCAGG - Intronic
1182856304 22:33520442-33520464 GAAGCTTGCTGTCTCCCTGCGGG - Intronic
1185218587 22:49617438-49617460 AGAGCTGGCACTCCCCCATCAGG + Intronic
951789356 3:26462561-26462583 ACAGGTTGATCTCTCCCAGCTGG - Intergenic
953193924 3:40714400-40714422 AAACATTGCTATACCCCAGCCGG + Intergenic
956406163 3:68931469-68931491 AAAGCTTGATCTCCTGCACCTGG - Intronic
956718325 3:72097888-72097910 CAACCTTTCTCTCTCCCAGCTGG - Intergenic
963101864 3:141615570-141615592 AAGTCTTGCTCTCCCCAGGCTGG + Intergenic
967280813 3:187821845-187821867 GAGGCATGCTCTCCCCAAGCAGG + Intergenic
967305163 3:188052335-188052357 AAATGTTGTTCTCTCCCAGCCGG - Intergenic
969473264 4:7402543-7402565 AATCCTAGCTCTCCCACAGCAGG - Intronic
973913936 4:55613754-55613776 GGAGCTTGCTCTCCCACAGCTGG + Intronic
977916604 4:102601236-102601258 AAAGTTTGCCTTCCCCCAGCGGG - Intronic
978896695 4:113896544-113896566 GAATCCTGCTCTCTCCCAGCTGG - Intergenic
979494888 4:121372000-121372022 AAGGGTTGCTCCTCCCCAGCAGG - Intronic
981718944 4:147779469-147779491 ACAGCTTGCTTTCCCCCCTCAGG - Intronic
982199921 4:152950213-152950235 AATGCTTGCTCTCTCAAAGCTGG - Intronic
1001266489 5:170278248-170278270 AAAGTTTCCTCTCCACTAGCAGG - Intronic
1004272854 6:14210991-14211013 AAAGCTTGCTCTTCCCTGTCAGG - Intergenic
1004780509 6:18903246-18903268 AAAGCTAGCTCTTTCACAGCGGG - Intergenic
1005166127 6:22923260-22923282 AGAGGTTTCTCTCCTCCAGCTGG + Intergenic
1009959511 6:70501348-70501370 CAAGCTTGATCTTCCCCAGTCGG + Intronic
1009991605 6:70849233-70849255 AAAGATTGCTGTCCCTAAGCAGG + Intronic
1015324604 6:131910134-131910156 AAGAGTTGCTCTCCCCCTGCTGG + Intergenic
1015830772 6:137366243-137366265 ACAGCTTGTTGTCCCCCAGGCGG - Intergenic
1016370894 6:143372810-143372832 CCAGCTTGCTCAGCCCCAGCCGG - Intergenic
1020024580 7:4889964-4889986 ATAGCATGCTCTTCCCAAGCTGG + Intergenic
1022288312 7:28976434-28976456 GAAGCTTGCTCTCAAGCAGCTGG + Intergenic
1025811700 7:64879825-64879847 AAAGCCTGTCCTCCTCCAGCGGG + Intronic
1032061977 7:128732462-128732484 AAAGCTGTCCATCCCCCAGCTGG + Intergenic
1033941886 7:146664976-146664998 GAGTCTTGCTCTCGCCCAGCTGG + Intronic
1035049214 7:155988821-155988843 GAAGGTGACTCTCCCCCAGCAGG - Intergenic
1037877508 8:22555169-22555191 TCAGCCTGCTCTCCCCAAGCGGG - Intronic
1041510640 8:58651408-58651430 AAAGCTTTCTATCACTCAGCTGG + Intronic
1042212486 8:66394636-66394658 ACAGCTTGGTCTTCCCAAGCAGG + Intergenic
1042593852 8:70424605-70424627 AAAGTTTGCTCTTCCACAGGAGG - Intergenic
1044141240 8:88655876-88655898 AAAGCTTGCTTTCACACAGTAGG - Intergenic
1044343535 8:91075469-91075491 AAAACTTGTTCCTCCCCAGCTGG + Intronic
1046285832 8:112092164-112092186 ACAGCTGCCTCACCCCCAGCTGG - Intergenic
1046762975 8:118040693-118040715 AAAGTTTTATCTCCTCCAGCAGG + Intronic
1048327829 8:133452574-133452596 GAGGCTGGCTCTTCCCCAGCAGG + Intergenic
1048884500 8:138898792-138898814 GAGGCTTGGTCTCCACCAGCAGG - Intronic
1049236087 8:141513123-141513145 AAGGCCTGCTCAGCCCCAGCAGG - Intergenic
1051618289 9:19027580-19027602 AAAGCTGACTGGCCCCCAGCTGG + Intronic
1053420524 9:37974700-37974722 GCAGCTTGCTCTCCCGCAGTCGG + Exonic
1056884480 9:90427953-90427975 AAAGCTGGCCACCCCCCAGCCGG - Intergenic
1060189336 9:121582220-121582242 AAAGCTTGCTCTCCCCCAGCCGG - Intronic
1060794936 9:126507102-126507124 CAAGCTCTCTCTCCCCCAGCAGG + Intergenic
1193916405 X:87370326-87370348 ATAGCTTGTTCTCTCCCAGTGGG - Intergenic
1194412458 X:93573790-93573812 AAATCTTGCTCTTTTCCAGCTGG + Intergenic
1196866779 X:120077784-120077806 AACGCGTGCTCTCCCTCATCCGG - Intergenic
1196876320 X:120158497-120158519 AACGCGTGCTCTCCCTCATCCGG + Intergenic
1199092263 X:143705724-143705746 CAAGCGTGCTCTCACCCAGCTGG - Intergenic
1202178117 Y:22116305-22116327 CAAGCTTTCTCTCTCCCAGGAGG - Intergenic
1202213244 Y:22470090-22470112 CAAGCTTTCTCTCTCCCAGGAGG + Intergenic