ID: 1060189336

View in Genome Browser
Species Human (GRCh38)
Location 9:121582220-121582242
Sequence AAAGCTTGCTCTCCCCCAGC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1060189336_1060189339 4 Left 1060189336 9:121582220-121582242 CCGGCTGGGGGAGAGCAAGCTTT No data
Right 1060189339 9:121582247-121582269 TTTTCCTGACTCGTGGTCCTGGG No data
1060189336_1060189338 3 Left 1060189336 9:121582220-121582242 CCGGCTGGGGGAGAGCAAGCTTT No data
Right 1060189338 9:121582246-121582268 CTTTTCCTGACTCGTGGTCCTGG No data
1060189336_1060189343 14 Left 1060189336 9:121582220-121582242 CCGGCTGGGGGAGAGCAAGCTTT No data
Right 1060189343 9:121582257-121582279 TCGTGGTCCTGGGGGTGAAGAGG No data
1060189336_1060189340 5 Left 1060189336 9:121582220-121582242 CCGGCTGGGGGAGAGCAAGCTTT No data
Right 1060189340 9:121582248-121582270 TTTCCTGACTCGTGGTCCTGGGG No data
1060189336_1060189337 -3 Left 1060189336 9:121582220-121582242 CCGGCTGGGGGAGAGCAAGCTTT No data
Right 1060189337 9:121582240-121582262 TTTGAACTTTTCCTGACTCGTGG No data
1060189336_1060189345 20 Left 1060189336 9:121582220-121582242 CCGGCTGGGGGAGAGCAAGCTTT No data
Right 1060189345 9:121582263-121582285 TCCTGGGGGTGAAGAGGTCAGGG No data
1060189336_1060189344 19 Left 1060189336 9:121582220-121582242 CCGGCTGGGGGAGAGCAAGCTTT No data
Right 1060189344 9:121582262-121582284 GTCCTGGGGGTGAAGAGGTCAGG No data
1060189336_1060189341 6 Left 1060189336 9:121582220-121582242 CCGGCTGGGGGAGAGCAAGCTTT No data
Right 1060189341 9:121582249-121582271 TTCCTGACTCGTGGTCCTGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1060189336 Original CRISPR AAAGCTTGCTCTCCCCCAGC CGG (reversed) Intronic