ID: 1060189341 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 9:121582249-121582271 |
Sequence | TTCCTGACTCGTGGTCCTGG GGG |
Strand | + |
Crispr in exon? | No |
Crispr in intron? | Yes |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | ||||
Summary |
Found 4 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1060189335_1060189341 | 7 | Left | 1060189335 | 9:121582219-121582241 | CCCGGCTGGGGGAGAGCAAGCTT | No data | ||
Right | 1060189341 | 9:121582249-121582271 | TTCCTGACTCGTGGTCCTGGGGG | No data | ||||
1060189330_1060189341 | 23 | Left | 1060189330 | 9:121582203-121582225 | CCAGAAATCAAAACATCCCGGCT | No data | ||
Right | 1060189341 | 9:121582249-121582271 | TTCCTGACTCGTGGTCCTGGGGG | No data | ||||
1060189336_1060189341 | 6 | Left | 1060189336 | 9:121582220-121582242 | CCGGCTGGGGGAGAGCAAGCTTT | No data | ||
Right | 1060189341 | 9:121582249-121582271 | TTCCTGACTCGTGGTCCTGGGGG | No data | ||||
1060189329_1060189341 | 24 | Left | 1060189329 | 9:121582202-121582224 | CCCAGAAATCAAAACATCCCGGC | No data | ||
Right | 1060189341 | 9:121582249-121582271 | TTCCTGACTCGTGGTCCTGGGGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1060189341 | Original CRISPR | TTCCTGACTCGTGGTCCTGG GGG | Intronic | ||