ID: 1060189343 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 9:121582257-121582279 |
| Sequence | TCGTGGTCCTGGGGGTGAAG AGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | Yes |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | ||||
| Summary |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1060189336_1060189343 | 14 | Left | 1060189336 | 9:121582220-121582242 | CCGGCTGGGGGAGAGCAAGCTTT | No data | ||
| Right | 1060189343 | 9:121582257-121582279 | TCGTGGTCCTGGGGGTGAAGAGG | No data | ||||
| 1060189335_1060189343 | 15 | Left | 1060189335 | 9:121582219-121582241 | CCCGGCTGGGGGAGAGCAAGCTT | No data | ||
| Right | 1060189343 | 9:121582257-121582279 | TCGTGGTCCTGGGGGTGAAGAGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1060189343 | Original CRISPR | TCGTGGTCCTGGGGGTGAAG AGG | Intronic | ||