ID: 1060196636

View in Genome Browser
Species Human (GRCh38)
Location 9:121628343-121628365
Sequence GTGTGAACAGACTCTGCCTC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1060196624_1060196636 17 Left 1060196624 9:121628303-121628325 CCCATCCTAGTGATCCTGAGGCA 0: 1
1: 0
2: 0
3: 16
4: 294
Right 1060196636 9:121628343-121628365 GTGTGAACAGACTCTGCCTCTGG No data
1060196621_1060196636 19 Left 1060196621 9:121628301-121628323 CCCCCATCCTAGTGATCCTGAGG 0: 1
1: 0
2: 2
3: 14
4: 159
Right 1060196636 9:121628343-121628365 GTGTGAACAGACTCTGCCTCTGG No data
1060196629_1060196636 -10 Left 1060196629 9:121628330-121628352 CCCCCCTGCCCAGGTGTGAACAG 0: 1
1: 0
2: 2
3: 37
4: 376
Right 1060196636 9:121628343-121628365 GTGTGAACAGACTCTGCCTCTGG No data
1060196618_1060196636 22 Left 1060196618 9:121628298-121628320 CCCCCCCCATCCTAGTGATCCTG 0: 1
1: 0
2: 1
3: 25
4: 221
Right 1060196636 9:121628343-121628365 GTGTGAACAGACTCTGCCTCTGG No data
1060196625_1060196636 16 Left 1060196625 9:121628304-121628326 CCATCCTAGTGATCCTGAGGCAG 0: 1
1: 0
2: 3
3: 30
4: 268
Right 1060196636 9:121628343-121628365 GTGTGAACAGACTCTGCCTCTGG No data
1060196626_1060196636 12 Left 1060196626 9:121628308-121628330 CCTAGTGATCCTGAGGCAGATGC 0: 1
1: 0
2: 2
3: 28
4: 253
Right 1060196636 9:121628343-121628365 GTGTGAACAGACTCTGCCTCTGG No data
1060196627_1060196636 3 Left 1060196627 9:121628317-121628339 CCTGAGGCAGATGCCCCCCTGCC 0: 1
1: 0
2: 3
3: 44
4: 967
Right 1060196636 9:121628343-121628365 GTGTGAACAGACTCTGCCTCTGG No data
1060196619_1060196636 21 Left 1060196619 9:121628299-121628321 CCCCCCCATCCTAGTGATCCTGA 0: 1
1: 0
2: 1
3: 10
4: 145
Right 1060196636 9:121628343-121628365 GTGTGAACAGACTCTGCCTCTGG No data
1060196623_1060196636 18 Left 1060196623 9:121628302-121628324 CCCCATCCTAGTGATCCTGAGGC 0: 1
1: 0
2: 1
3: 31
4: 408
Right 1060196636 9:121628343-121628365 GTGTGAACAGACTCTGCCTCTGG No data
1060196620_1060196636 20 Left 1060196620 9:121628300-121628322 CCCCCCATCCTAGTGATCCTGAG 0: 1
1: 0
2: 1
3: 8
4: 116
Right 1060196636 9:121628343-121628365 GTGTGAACAGACTCTGCCTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1060196636 Original CRISPR GTGTGAACAGACTCTGCCTC TGG Intronic
No off target data available for this crispr