ID: 1060200002

View in Genome Browser
Species Human (GRCh38)
Location 9:121646673-121646695
Sequence CACACTAGGCCCCACACAAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 122
Summary {0: 1, 1: 0, 2: 1, 3: 28, 4: 92}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1060200002_1060200007 1 Left 1060200002 9:121646673-121646695 CCCATTGTGTGGGGCCTAGTGTG 0: 1
1: 0
2: 1
3: 28
4: 92
Right 1060200007 9:121646697-121646719 GCTCCGATGCTTCCCCTGTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1060200002 Original CRISPR CACACTAGGCCCCACACAAT GGG (reversed) Intronic
900585189 1:3429226-3429248 CAAACCAAGCCCCACAGAATGGG - Intronic
900973573 1:6004794-6004816 CACAGTCCACCCCACACAATAGG + Intronic
903532615 1:24043362-24043384 CCCACAAGGCCCTACACAAATGG + Intergenic
903532675 1:24043828-24043850 CCCACAAGGCCCTACACAAATGG - Intergenic
904005750 1:27362308-27362330 CACACTCGGGCCCACAGAAATGG - Intronic
905842864 1:41199709-41199731 CACACTAGGGACTCCACAATAGG + Intronic
906324420 1:44835909-44835931 CACTCTAGGCCCTCCATAATTGG - Intronic
910936553 1:92487360-92487382 CACAGCAGGCCACACACTATGGG - Intergenic
913346658 1:117817005-117817027 CATAATAGGCCACACATAATAGG + Intergenic
913538931 1:119800459-119800481 CACACTGGGCACCTCACATTCGG + Intronic
915318694 1:155044087-155044109 CACTCTAGGCCCCCCACATAGGG - Intronic
918115994 1:181498129-181498151 CACACTATGACTCACACTATGGG - Intronic
918303401 1:183224354-183224376 CACACAAGGCCCAACATGATGGG - Intronic
1063378913 10:5572063-5572085 CACACCTGGCCCCACACCTTGGG + Intergenic
1067414537 10:46093518-46093540 CACACTAGACACCACACACCAGG + Intergenic
1069695003 10:70380168-70380190 TACACTCTGACCCACACAATAGG - Intronic
1070462381 10:76682824-76682846 CTAACCAGGCCCCACCCAATTGG - Intergenic
1075580944 10:123617906-123617928 CACACAAAGACTCACACAATGGG + Intergenic
1076329222 10:129652651-129652673 CACAGAAGCCCCCACACAGTAGG - Intronic
1076911368 10:133391829-133391851 CACACATGGCCCCACACTCTGGG + Intronic
1081006194 11:37746403-37746425 AACACTAGGCCCCAGAAATTTGG - Intergenic
1082228157 11:49732499-49732521 CAGACTAGGACTCACACCATTGG + Intergenic
1083708365 11:64531978-64532000 CACACCAGGCCCCACTGAAATGG - Intergenic
1086393524 11:86390423-86390445 CATATAAGGCCCCTCACAATTGG - Intronic
1089279685 11:117364975-117364997 CAGACTAGGCCCCACTCAGAAGG - Intronic
1092381384 12:7999778-7999800 CTCAATAGGCCCCACACCACTGG - Intergenic
1101543016 12:105682248-105682270 CTCAACAGGCCCCACACAATTGG - Intergenic
1102648106 12:114416881-114416903 AACACTCAGCCTCACACAATAGG + Intergenic
1104007529 12:124904467-124904489 TACACTGGGCCCCACAGAAGGGG + Intergenic
1104677391 12:130721469-130721491 AACTCCAGGCCCCACAAAATTGG - Intergenic
1105450750 13:20497156-20497178 CACAATAGGCCAGACACAAGAGG + Intronic
1105853526 13:24357360-24357382 CACACACGGCCACACACACTGGG + Intergenic
1109712734 13:66181237-66181259 CTCAACAGGCCCCACACCATTGG + Intergenic
1115130636 14:30048857-30048879 CTCAACAGGCCCCACACCATTGG - Intronic
1121244755 14:92453679-92453701 CACACTGGGCTTCACACACTAGG + Intronic
1122128757 14:99593148-99593170 CATTCAGGGCCCCACACAATCGG + Intronic
1122522024 14:102351349-102351371 CACACCAGGCAGCACAGAATAGG + Intronic
1124142397 15:27088764-27088786 CCCACCAGGCCCCTCACAATTGG + Intronic
1128033008 15:64498409-64498431 AACACCAGGCCTCACACCATAGG - Intronic
1129778089 15:78250015-78250037 AACACTAGCCTCCACACAAAAGG - Intergenic
1131886394 15:96918876-96918898 CAAACTAGGCCCCTGACAATTGG + Intergenic
1132645779 16:998664-998686 CACACCAGGTGCCACACAGTGGG + Intergenic
1136049840 16:27642405-27642427 CACAGCAGGCCCCCCACAACAGG - Intronic
1137793189 16:51192607-51192629 CACACTAGGACCCACTCACGAGG - Intergenic
1141882666 16:86870123-86870145 CAAACCAGGCCCCCCACAACTGG - Intergenic
1145405834 17:22591424-22591446 CACACTAGGTCCTACTAAATGGG + Intergenic
1147547730 17:41415878-41415900 CACAGTAGGCCGCACATAGTAGG - Intergenic
1149563963 17:57628632-57628654 CACCCTCTGACCCACACAATCGG - Intronic
1150281970 17:63934090-63934112 CAGAGTAGGCCCCACACCACAGG - Intergenic
1151615124 17:75205177-75205199 CACACTAGAACACACACAAGAGG - Intergenic
1152700220 17:81814958-81814980 CAGGTTGGGCCCCACACAATGGG - Intergenic
1155256460 18:24002108-24002130 CCCACAAGACCACACACAATGGG - Intronic
1155823612 18:30409717-30409739 CAAAGTAGGCCTCACACAAGGGG - Intergenic
1156867968 18:41909668-41909690 AACATTAGGCCCCTCAAAATGGG - Intergenic
1161495752 19:4584786-4584808 CACACGTGGCCCCAGCCAATCGG - Intergenic
1163766807 19:19167882-19167904 AACACTAGGCCCCTCAAAAAAGG - Intronic
1164934589 19:32201084-32201106 CACACTCAGCCCCTCACCATGGG + Intergenic
1166888598 19:45975965-45975987 CACACTTGGCCCCACACACTCGG + Intergenic
1167807201 19:51796281-51796303 CACACTGGGCTCCACCCACTGGG - Intronic
926691319 2:15736101-15736123 CAGTCTAGGCCCAACACAAGTGG + Intronic
928722880 2:34140900-34140922 CCCACTAGGCCCTATACACTGGG + Intergenic
939805819 2:146775083-146775105 CACAATAGGCCTCCCACAATAGG - Intergenic
942598904 2:177620054-177620076 CACACTTAGCACCAAACAATGGG - Intergenic
943517654 2:188907658-188907680 CTCAATGGGCCCCACACCATTGG + Intergenic
946638542 2:221757451-221757473 CACACTAGGGCAGCCACAATAGG + Intergenic
1171988985 20:31681117-31681139 CCTACCAGGCCCCACACAATCGG - Intronic
1174284064 20:49459888-49459910 CATACTAGCCCCATCACAATGGG - Intronic
1175212011 20:57365219-57365241 TACACTGGTCCCCAAACAATTGG + Intronic
1175845692 20:62057638-62057660 CACACCAGGCCACAGACAATGGG + Intronic
1175845711 20:62057712-62057734 CACACCAGGCCACAGACAATGGG + Intronic
1175845730 20:62057786-62057808 CACACCAGGCCACAGACAATGGG + Intronic
1175845748 20:62057860-62057882 CACACCAGGCCACAGACAATGGG + Intronic
1175845765 20:62057933-62057955 CACACCAGGCCACAGACAATGGG + Intronic
1175845784 20:62058007-62058029 CACACCAGGCCACAGACAATGGG + Intronic
1175845801 20:62058080-62058102 CACACCAGGCCACAGACAATGGG + Intronic
1175845818 20:62058153-62058175 CACACCAGGCCACAGACAATGGG + Intronic
1175845837 20:62058227-62058249 CACACCAGGCCACAGACAATGGG + Intronic
1175845854 20:62058300-62058322 CACACCAGGCCACAGACAATGGG + Intronic
1175845872 20:62058374-62058396 CACACCAGGCCACAGACAATGGG + Intronic
1175845890 20:62058448-62058470 CACACCAGGCCACAGACAATGGG + Intronic
1175845907 20:62058521-62058543 CACACCAGGCCACAGACAATGGG + Intronic
1175845924 20:62058594-62058616 CACACCAGGCCACAGACAATGGG + Intronic
1175845943 20:62058668-62058690 CACACCAGGCCACAGACAATGGG + Intronic
1175845962 20:62058742-62058764 CACACCAGGCCACAGACAATGGG + Intronic
1175845979 20:62058815-62058837 CACACCAGGCCACAGACAATGGG + Intronic
1175845996 20:62058888-62058910 CACACCAGGCCACAGACAATGGG + Intronic
1175846013 20:62058961-62058983 CACACCAGGCCACAGACAATGGG + Intronic
1179180063 21:39037370-39037392 CACACTAGATCCCACGCAATGGG - Intergenic
1179458250 21:41514549-41514571 CTCAATAGGCCCCACACCACTGG + Intronic
1181838690 22:25634408-25634430 CACACTAGCTCCCATATAATTGG - Intronic
949417661 3:3831296-3831318 CTCACCAGGCCCCACACCACTGG + Intronic
954225151 3:49176483-49176505 CACACCAGGGTCCACACACTAGG - Exonic
954792528 3:53143811-53143833 CAAACTAGGCCACACAGCATGGG + Intergenic
956113190 3:65891718-65891740 CACAACAGGCCCCAGACAACAGG - Intronic
961535554 3:127568487-127568509 CACTCTAGGCCACTCACACTAGG + Intergenic
975745714 4:77472448-77472470 CACACTAGGTCTCACAGATTAGG + Intergenic
976095775 4:81506814-81506836 TCAACTATGCCCCACACAATAGG - Intronic
977169545 4:93743753-93743775 CCCATTAGGCCCCACCTAATGGG + Intronic
979672195 4:123371687-123371709 CACACCAGGCCCCACGGCATAGG + Intergenic
980456210 4:133046821-133046843 CACACTAGGTCCCTGGCAATGGG + Intergenic
987227525 5:15859090-15859112 CACACTGGGGCACAGACAATTGG - Intronic
988056622 5:26105677-26105699 CTCAACAGGCCCCACACCATTGG + Intergenic
988092551 5:26562196-26562218 CAAACTGGGCCCCACACCACTGG - Intergenic
992207398 5:74444379-74444401 CACTCTAGGCCCAACACTCTAGG + Intergenic
992314667 5:75540187-75540209 CACACTACGCTCCACACTATTGG - Intronic
1000223304 5:159234663-159234685 CTCAATAGGCCCCACACCACTGG + Intergenic
1018220470 6:161573087-161573109 GACACTCGGCCCCAGACCATGGG - Intronic
1025204655 7:56985291-56985313 CACCCTGGGCCTCACAGAATGGG + Intergenic
1025667282 7:63591644-63591666 CACCCTGGGCCTCACAGAATGGG - Intergenic
1034063360 7:148113443-148113465 CCCACCAGGCCCCACAACATTGG + Intronic
1034880494 7:154759011-154759033 GACTCTAGGCCCCTCAAAATTGG - Intronic
1039939053 8:42073304-42073326 CACTCTATGCCCCACACACATGG - Intergenic
1040797334 8:51300317-51300339 CACACTAGGCTGCACACAACAGG + Intergenic
1047433763 8:124817120-124817142 CACAATAGGCCTCACAGAAAAGG + Intergenic
1048071210 8:131023019-131023041 CTCACTTGGCCACACACAATCGG + Intronic
1048843181 8:138582627-138582649 CCCACTATGCCCCACCCACTCGG + Intergenic
1056806999 9:89736671-89736693 AACACTAGGCCCTACACTAGAGG + Intergenic
1060200002 9:121646673-121646695 CACACTAGGCCCCACACAATGGG - Intronic
1186082842 X:5952083-5952105 CATCCTAGGCCCCACAAAAGTGG - Intronic
1189886007 X:45545710-45545732 CCCACCAGGCCCCACCCATTGGG + Intergenic
1197245106 X:124159413-124159435 CTCAACAGGCCCCACACCATTGG + Intronic
1199310485 X:146314831-146314853 CTCAATAGGCCCCACACCACTGG + Intergenic