ID: 1060201196

View in Genome Browser
Species Human (GRCh38)
Location 9:121652500-121652522
Sequence CCCGGGGGCTGCGTTTGGGC GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1060201187_1060201196 0 Left 1060201187 9:121652477-121652499 CCTCGGCTGGAAATGCGTGTGAT No data
Right 1060201196 9:121652500-121652522 CCCGGGGGCTGCGTTTGGGCGGG No data
1060201185_1060201196 13 Left 1060201185 9:121652464-121652486 CCAGTAACAGGATCCTCGGCTGG No data
Right 1060201196 9:121652500-121652522 CCCGGGGGCTGCGTTTGGGCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1060201196 Original CRISPR CCCGGGGGCTGCGTTTGGGC GGG Intronic