ID: 1060201317

View in Genome Browser
Species Human (GRCh38)
Location 9:121653080-121653102
Sequence ACTTCAGGAAAGGCAGGAGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 380
Summary {0: 1, 1: 0, 2: 3, 3: 27, 4: 349}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1060201317 Original CRISPR ACTTCAGGAAAGGCAGGAGT GGG (reversed) Intronic
900085652 1:894465-894487 ACCACAGCAAAGGCAGGAGGAGG + Intergenic
900343135 1:2198006-2198028 ACTTGAGGACAGGCAGGACAAGG - Intronic
903203080 1:21759279-21759301 ACTGAAGGGAAGGCAGGAGTGGG + Intronic
903583527 1:24390531-24390553 GCCTCAGGAGAGGCAGTAGTTGG + Intronic
904293607 1:29503613-29503635 AGTTCAGGAGAGGGAGGAGGGGG - Intergenic
904866792 1:33585714-33585736 ACTTCTGGGAAAGCAAGAGTAGG - Intronic
904895304 1:33812873-33812895 ACTTCAGGAAAGGCAGAAAAAGG - Intronic
905548115 1:38816247-38816269 ACTCCAGGAGAGGCAGCGGTGGG + Intergenic
906090663 1:43176829-43176851 ACTGAAGGAAAGGAAGGAGCTGG + Intronic
906400243 1:45499235-45499257 AGTTCAGGAAAGGACAGAGTTGG + Intronic
907112756 1:51941223-51941245 ACTTCAGGAACGGTAGGGGATGG + Intronic
907746277 1:57216844-57216866 ACTTGACGTAAGGCAGGACTGGG + Intronic
908015953 1:59836296-59836318 ACTTCAGGAAAAGCAGACTTTGG + Intronic
910455689 1:87395182-87395204 AAATCAGGAAAAGCAGCAGTGGG + Intergenic
910842190 1:91571301-91571323 GCTTAGGGAAAGGCAGAAGTGGG - Intergenic
912261083 1:108112037-108112059 ACTTCAGGGGAGGCAGGTCTGGG - Intergenic
913059675 1:115193610-115193632 CCTGCAGGAATGGCAGCAGTGGG - Intergenic
914753694 1:150551561-150551583 ACCTCTGGGAGGGCAGGAGTGGG + Intronic
915128304 1:153680440-153680462 ACTGCGGGAGAGACAGGAGTAGG - Intronic
915270542 1:154750422-154750444 ACTTAAGGAAAGGAAGGAGCAGG + Intronic
916201511 1:162275907-162275929 AAATGAGGTAAGGCAGGAGTTGG + Intronic
916852963 1:168722748-168722770 ACTTGAGTAAAGGTAGTAGTGGG + Intronic
917051451 1:170929299-170929321 ACTTCAGGAAAAGCCTGAGGGGG - Intergenic
921308700 1:213821855-213821877 GCTTCAGACAAGACAGGAGTTGG + Intergenic
921434028 1:215095975-215095997 AAATCAGGGAAGGCAAGAGTGGG + Intronic
921896755 1:220409894-220409916 ACTTCAGGGAGGGGAGGGGTTGG + Intergenic
922024031 1:221733997-221734019 ACTTCCTGAAAGACAGGAGCAGG + Intronic
922460788 1:225813115-225813137 ATTTCAGGAAAGGAATGTGTAGG + Intronic
922533632 1:226363732-226363754 ACTTCAGGAAATGCAAGGGCAGG - Intronic
923187646 1:231589560-231589582 ACTTCAGTAAAGCCAGGGTTGGG - Intronic
923525780 1:234771645-234771667 ACTGAAGGAGAGGCAGGAATGGG + Intergenic
923923880 1:238601457-238601479 AGTAAAGGAAAGGCAGGAATGGG - Intergenic
924812640 1:247416668-247416690 ACCTCAGGATGGGCAGGAGCTGG + Intronic
1063169723 10:3496698-3496720 AATCCAGGAAAGGAAGGAGAGGG + Intergenic
1063779033 10:9299864-9299886 ACTTAAAGAAATGCAGAAGTCGG + Intergenic
1064636810 10:17377068-17377090 TCATCAGTAAAGGCAGGAATTGG - Intronic
1064668379 10:17681800-17681822 ACTTCAGTAAATGGAGGACTTGG + Intronic
1064696470 10:17971290-17971312 ACATCAGGAAAGGAAGGGGAGGG - Intronic
1068489321 10:57702143-57702165 ACTTCAGTGAAGTAAGGAGTGGG - Intergenic
1069256614 10:66339676-66339698 ACTACAGGAAAGATAGGAATTGG - Intronic
1069853663 10:71426490-71426512 ACTTCAGGTGAGGCAGGAGGGGG + Intronic
1070816557 10:79328204-79328226 CCCTGGGGAAAGGCAGGAGTGGG + Intergenic
1072047635 10:91672584-91672606 ATTCCAGGAAACCCAGGAGTGGG + Intergenic
1072303509 10:94085180-94085202 ACATGAGGACAGGCAGGATTTGG + Intronic
1074458514 10:113615749-113615771 ACTTCAGGGAGGTCAGCAGTCGG + Exonic
1074569539 10:114611975-114611997 GTGTCAGGAAAGGCAGGACTGGG - Intronic
1074683900 10:115940104-115940126 ACTCAAGGACAGGCAGGAATGGG + Intronic
1075074163 10:119339512-119339534 AGTACCCGAAAGGCAGGAGTGGG + Intronic
1075087610 10:119423987-119424009 ACTCCATGAAAGCCAGGATTGGG - Intronic
1075708631 10:124518383-124518405 TTTGCAGGAAAGGCAGGATTGGG - Intronic
1076485828 10:130816368-130816390 TCTTCATGAAAGGAAGGTGTGGG + Intergenic
1076976978 11:180380-180402 ATTTCAGGACAGCCAGGAGGGGG - Intronic
1078682357 11:13488701-13488723 ACTCCAGGTAAGACAGAAGTGGG - Intergenic
1079543483 11:21604663-21604685 ACTCTATGAAAGGAAGGAGTGGG - Intergenic
1079600268 11:22303636-22303658 ACTTCAAGAAAGGAAGGAAGAGG + Intergenic
1080426839 11:32162904-32162926 ACCTCAAGAAAGCCAGGGGTAGG + Intergenic
1083072260 11:59997293-59997315 ACTACAGAAAAGCCAGAAGTAGG - Intergenic
1083089278 11:60183707-60183729 ACTTGAGGGTAGGCAGCAGTTGG - Intronic
1083656774 11:64233841-64233863 ACTTCAGGGACAGCAGGAATTGG + Intronic
1084166764 11:67378707-67378729 ACTTCAGCAACAGCAGGACTTGG + Intronic
1084943364 11:72626037-72626059 ACTCAGGGAAAGGCAGGAGCTGG - Intronic
1085745806 11:79113223-79113245 CATTCAGGAAAGGGAGGAGGAGG + Intronic
1086073068 11:82820325-82820347 ATTTAAGGAAAGGCTGTAGTGGG + Intergenic
1086132796 11:83419253-83419275 ACATCAGTTAAGGCAGGAGCAGG - Intergenic
1087012297 11:93525560-93525582 CCTGCAGGAGAGCCAGGAGTGGG - Intronic
1087191850 11:95263009-95263031 ACTTCAGAAAAGTGAGGAATTGG - Intergenic
1088366318 11:109043889-109043911 GCCACAGGAAAGGCAGGAGGTGG + Intergenic
1089278138 11:117353483-117353505 GCTTGACGAAAGGCAGGAGACGG + Intronic
1089597404 11:119589609-119589631 ACTTCCTGCAAGACAGGAGTAGG - Intergenic
1090154745 11:124425466-124425488 CCATCAGGAAAGACAGGATTCGG + Intergenic
1090457724 11:126864372-126864394 ACTTGGAGAAAGGCAGGTGTGGG + Intronic
1091038707 11:132256746-132256768 ACTTCAGGAGAGGCAGAGGTGGG + Intronic
1091563986 12:1634461-1634483 ACTTTAGGAAAGAAAGGGGTTGG + Intronic
1092385830 12:8034844-8034866 TCTTCAGAAAAGGCAGGAAAAGG + Intronic
1092921352 12:13234388-13234410 ATTTCAGGAAAGGCTGGATATGG - Intergenic
1094076541 12:26482185-26482207 ACCTCAGGACAGGTAGGAGATGG - Intronic
1094523872 12:31219201-31219223 AATGAAGGAAAGGGAGGAGTCGG - Intergenic
1099932058 12:89086268-89086290 GCTTGAGGAAAGGAAGGATTTGG + Intergenic
1102061568 12:109936033-109936055 ACTTCAGGAAGGTCAGGGGCTGG + Intronic
1103506202 12:121443572-121443594 GCCTCAGGAGAGGCAGCAGTGGG + Intronic
1103733873 12:123046180-123046202 CCTTCAGGAAAGGCAGGACTGGG - Intronic
1103958589 12:124593451-124593473 ACTCCAGGCAAGGAAGGAGGAGG - Intergenic
1104669828 12:130673103-130673125 CCTTCAGGAAGGGCGGGAGCAGG - Intronic
1106090833 13:26591770-26591792 AGATCAGGAAAGGAGGGAGTCGG + Intronic
1106371466 13:29137968-29137990 ACTTCAGGATGAGCAGGAGGGGG + Intronic
1106970815 13:35139620-35139642 AGTTCAGGAAAGGCTTCAGTGGG - Intronic
1107050222 13:36039150-36039172 ATTTCAGGTAAGGAATGAGTAGG + Intronic
1107604749 13:42047093-42047115 CCTTTAGGAAAGGAAGGAGTTGG - Intronic
1107819343 13:44272194-44272216 AAGACAGGAAAGGCAGGAGCTGG + Intergenic
1108493474 13:51003110-51003132 ACTCCAGGAAGGAGAGGAGTGGG + Intergenic
1109726375 13:66346649-66346671 ACTTCTGGAAATGCAGAACTGGG + Intronic
1110678296 13:78277125-78277147 ACTACAGGGATGGGAGGAGTCGG - Intergenic
1111855691 13:93634310-93634332 AGTTGAGGACAGGCAGGAGGTGG - Intronic
1113252568 13:108470652-108470674 GCATCAGCAAATGCAGGAGTTGG - Intergenic
1113658197 13:112083647-112083669 ACTTTGGGAAAGACGGGAGTAGG - Intergenic
1114192609 14:20451709-20451731 ACTTCAGGAAAGGAATGAATGGG - Intronic
1114668599 14:24397101-24397123 CCTCCAGGAGAGGCAGGAGCTGG + Intergenic
1115271928 14:31562176-31562198 GCTTCTGGAAAGGGTGGAGTCGG + Exonic
1115434466 14:33357467-33357489 ACTGTAGGAAAGGCAGAAGCTGG + Intronic
1115513890 14:34166197-34166219 ACCTCAGGAAAAGCAGAAGCCGG + Intronic
1116006247 14:39295008-39295030 ACTTCAGGAAAGCCAGAAACAGG + Exonic
1118394146 14:65321458-65321480 ACTTCAGGAAAGGAAGTGGTGGG + Intergenic
1118478587 14:66141683-66141705 AGTTCAGTGGAGGCAGGAGTGGG - Intergenic
1119211647 14:72836443-72836465 CCTTCAGGGCAGGCAGGAGCAGG - Intronic
1120865342 14:89291555-89291577 ACTGCTGGAAAGACTGGAGTGGG - Intronic
1121067463 14:90982175-90982197 AGTGAATGAAAGGCAGGAGTTGG - Intronic
1122540837 14:102496939-102496961 CTTTCAGGGAAGGCAGGAGTTGG - Intronic
1122896052 14:104757573-104757595 GCTTCAGCATGGGCAGGAGTGGG + Intronic
1123704831 15:22943753-22943775 CCTTCAGCAAAGGGAGGAGATGG - Intronic
1124394739 15:29291307-29291329 AGTACAGCTAAGGCAGGAGTGGG - Intronic
1124456156 15:29844658-29844680 ACTTCTGGAAAAGCAGGTTTTGG + Intronic
1124628199 15:31322224-31322246 AATTCAGAAAAGGGAGGAGGGGG - Intergenic
1125609355 15:40960316-40960338 CCTGGAGGAAAGGCAGGAGCTGG + Intergenic
1126606432 15:50481705-50481727 ACTTCGGGAAAGGCAGCAAGAGG + Exonic
1128675176 15:69603183-69603205 GTCTCTGGAAAGGCAGGAGTGGG + Intergenic
1131073006 15:89477641-89477663 ACTCCAGGAATGGCTGGAGACGG + Exonic
1131579221 15:93625630-93625652 ATCTCAGGAGAGGCAGAAGTAGG + Intergenic
1132339549 15:101069261-101069283 ACTTGAGGTAGGGCAGGAGGGGG + Exonic
1132627779 16:900033-900055 ACTCAAGGAAAGCCAGGATTTGG - Intronic
1133001160 16:2852439-2852461 GCTTCAGGAAGGGGAGGAGAGGG - Intergenic
1133447456 16:5874285-5874307 CTTGAAGGAAAGGCAGGAGTTGG + Intergenic
1133648432 16:7786390-7786412 TCGTCAGGAAAGGAAGGGGTAGG - Intergenic
1134239858 16:12497545-12497567 ACTTCAGGAGTGGCTGGAGTCGG + Intronic
1134375013 16:13664064-13664086 ACTTCAGGAAGGGAAGGAAATGG - Intergenic
1135062615 16:19283755-19283777 AGCTCAGGTATGGCAGGAGTGGG + Intergenic
1135928250 16:26714206-26714228 TCTGCAGGAAAGACAGGATTTGG - Intergenic
1137274854 16:46926708-46926730 ACTGCAGGACAGCCAGGTGTAGG - Intronic
1137705923 16:50535814-50535836 TCGGCAGGAGAGGCAGGAGTGGG - Intergenic
1138123389 16:54418971-54418993 ACTTCATGAAGGGAAGGAGCAGG + Intergenic
1138433434 16:56983793-56983815 CCTTTAGGATAGGGAGGAGTTGG - Exonic
1140054648 16:71515427-71515449 ACTTCAGAAGAGGCAGGATTCGG + Intronic
1140223431 16:73059939-73059961 ACTTCAGGAAAGACAAGAAAAGG + Intergenic
1141336984 16:83165297-83165319 TCTTCAAGACAGGCAGGGGTGGG - Intronic
1142020249 16:87777824-87777846 ACTTCCTGGAAGGCGGGAGTTGG - Intergenic
1142443282 16:90116290-90116312 ATTTCAGGACAGCCAGGAGGGGG + Intergenic
1142464115 17:118554-118576 ATTTCAGGACAGCCAGGAGGGGG - Intergenic
1142599591 17:1047148-1047170 CCTGTAGGAAAGGCAGGAGGAGG - Intronic
1142603981 17:1071616-1071638 ACAGCAGGAAAGGCTGGCGTTGG - Intronic
1143058984 17:4184369-4184391 ACCTCAGGACAGGCAAGAGAAGG + Intronic
1144370407 17:14584809-14584831 ACTTCGGGGAAGAAAGGAGTGGG + Intergenic
1145194906 17:20883811-20883833 ACTTCAGAAAAAGGAAGAGTGGG - Intronic
1146151051 17:30472577-30472599 ACTGCAGGGAAGTCAGGAGAGGG + Intergenic
1148243289 17:46013772-46013794 CTTGCTGGAAAGGCAGGAGTGGG - Intronic
1150223342 17:63509401-63509423 TCTTCAGGAAGGGCAGGACCGGG - Intronic
1152336864 17:79703639-79703661 ATCTCAGCAAAGGCAGGAGCAGG + Intergenic
1152941695 17:83176139-83176161 GCTTCTAGAAAGGCTGGAGTAGG - Intergenic
1153237298 18:3000299-3000321 AGGTAGGGAAAGGCAGGAGTTGG + Intronic
1155001250 18:21689197-21689219 ACCTGAGGGAAGGCAGTAGTTGG + Intronic
1156039860 18:32808653-32808675 ACATTTTGAAAGGCAGGAGTTGG + Intergenic
1156193778 18:34750024-34750046 ACTTCAGGGAGTGCAGCAGTTGG + Intronic
1157627916 18:49067094-49067116 AGTTCAGTAGAGGAAGGAGTGGG + Intronic
1157930727 18:51820309-51820331 CCTCCAGCAAAGGCAGGAGGTGG - Intergenic
1158419228 18:57278222-57278244 ACTCCAGGAAAGGAGGGAGCAGG + Intergenic
1158856627 18:61549432-61549454 TCTTTAGGAAACACAGGAGTTGG + Intronic
1158870425 18:61681823-61681845 ACCTCAGGAAGGGCTGGACTGGG + Intergenic
1159004693 18:63001927-63001949 ACTCCAGGAGAGGACGGAGTTGG + Intergenic
1159249095 18:65850438-65850460 TCTTCAGAAAAGAGAGGAGTAGG + Intronic
1159516147 18:69460816-69460838 ACTGCAGGAAAGGCAGAGGTAGG - Intronic
1159602142 18:70438247-70438269 ACTTAAAGAAAGGCAAGCGTTGG - Intergenic
1160832975 19:1111971-1111993 ACTGCAGGGAAGGCAGGGTTGGG - Intronic
1163008177 19:14409231-14409253 ACTTGAGGAAAAGCAGGGCTGGG + Intronic
1163435499 19:17292807-17292829 GCTTCAGGAATGCCAGGAGCAGG + Exonic
1164157078 19:22603444-22603466 CCTTCAGCAAAGCCAGGAGAAGG + Intergenic
1165241643 19:34473301-34473323 ATTTCAAAAAAGGAAGGAGTAGG + Intergenic
1166132012 19:40751274-40751296 AAGTCAGGTAAGGCGGGAGTAGG - Exonic
1166136245 19:40778709-40778731 ACTGCATGAATGGCAGGAGTCGG + Intronic
1166303632 19:41925816-41925838 TCTTCTGGAAGGGCAGGTGTTGG + Intronic
1166413956 19:42578223-42578245 ACTTCAGGAGTGGAAGGATTGGG + Intergenic
1167530435 19:50012578-50012600 GCATTAGGAAAGGCAGGGGTTGG + Intronic
925041669 2:735866-735888 ACTGCAGGAGAGGCAGGAGTGGG + Intergenic
925392218 2:3503686-3503708 AGGTCAGGAAAAGCAGGAGGTGG + Intronic
927181810 2:20452093-20452115 AATTCAGGAATGGCAGAAATAGG - Intergenic
927666087 2:25033852-25033874 ACTTGAGCAAAAGCAGGTGTTGG - Intergenic
929330103 2:40672786-40672808 AGTACAGGAAAAGCAGGAGCTGG - Intergenic
930219648 2:48733519-48733541 AGAGCAGGAAAGGCAGCAGTGGG + Intronic
930621891 2:53652518-53652540 GCTTCAGGAAAGAAAGGAGATGG + Intronic
932332525 2:70905784-70905806 GCTACAGGAAAGGGAGGAGATGG + Intronic
932362334 2:71119071-71119093 TCTTCAGGAAGGGAAGGAATGGG + Intronic
933661707 2:84932916-84932938 GCTACTGGAAAGGCAGAAGTGGG + Intergenic
934695895 2:96399925-96399947 ATTTCAGGAATGTCAGGAGCAGG - Intergenic
934851567 2:97705234-97705256 GCCTCAGGAAAGGCAGGGGAAGG + Intergenic
937285458 2:120748108-120748130 ACTTTAGGAAAGGCATGATCTGG + Intronic
937900020 2:127012624-127012646 ACCTCCGGAAAGGCAGGGATGGG - Intergenic
938150472 2:128878280-128878302 TCCTCAGGACAGGCAGTAGTAGG + Intergenic
938572134 2:132570454-132570476 ACTCCTGAAAAGGCAGGAGGGGG - Intronic
938723849 2:134089659-134089681 ACTTAAGCACAGCCAGGAGTTGG - Intergenic
938804988 2:134797793-134797815 TCTTCAGAAAAGGAAGCAGTGGG - Intergenic
940489524 2:154340333-154340355 GCTACAGGAAAGGCTGAAGTGGG - Intronic
940614953 2:156038432-156038454 AACTCAGGCAAGGCAGGAGTTGG + Intergenic
941006256 2:160250213-160250235 ACATAAGTAAAGGCAGGAATTGG + Intronic
942242177 2:173972740-173972762 ACTACAGGACAGTGAGGAGTTGG - Intergenic
942261179 2:174165549-174165571 TCTCCAGCAAAGGCAGGAATAGG - Intronic
942656591 2:178220245-178220267 ACTTAAAAAAAGGCAGGGGTGGG - Intronic
943311244 2:186327816-186327838 ACCAAAGAAAAGGCAGGAGTAGG - Intergenic
945928379 2:215829372-215829394 ACTTCAGGAAAGGTGTGACTTGG - Intergenic
946288048 2:218720428-218720450 ACATCAGCAAAGCCACGAGTTGG - Intronic
948109206 2:235440705-235440727 CCATCAGGAAAGACAGGAGCTGG + Intergenic
1169100301 20:2941746-2941768 ACCTCAGAAAGGGCAGGAGCAGG - Intronic
1169130987 20:3166360-3166382 ACTGCAGGAAACGCAGGAGGGGG + Exonic
1169919831 20:10723289-10723311 ACTTCCAGAATGGCAGCAGTAGG + Intergenic
1170464629 20:16611441-16611463 ACTTCTGGGAAGGCAGCAGCTGG - Intergenic
1170529361 20:17274701-17274723 AATTCAGGAAAGACATGACTGGG - Intronic
1170928274 20:20745416-20745438 ACCTTAGCAGAGGCAGGAGTGGG - Intergenic
1170965374 20:21064601-21064623 ACTTCAGGAGAGACAGAATTAGG + Intergenic
1171327469 20:24307912-24307934 ACTCCAGGAAGGGAAGGAGAAGG - Intergenic
1173506023 20:43587804-43587826 ACTTGAGGAAGGGAAAGAGTGGG - Intronic
1174137080 20:48387101-48387123 ACTTGGGGAATGGCAGGAGCAGG - Intergenic
1174477733 20:50808331-50808353 ACTTCAAGATACCCAGGAGTGGG + Intronic
1175001544 20:55634208-55634230 ACTGCAGGGAAGGCACGAGGAGG - Intergenic
1175234801 20:57502465-57502487 TCTTGAGGAAAGGCAGGTGGAGG + Intronic
1176011078 20:62895999-62896021 ACTTCAGGGAAGCCAGGAAGCGG + Intronic
1176900644 21:14437696-14437718 ACTGGAGGAAAGGAAGCAGTGGG + Intergenic
1177054677 21:16286431-16286453 ACTTCAAAAATGGCATGAGTTGG - Intergenic
1177998287 21:28130175-28130197 AATTTAGGAATGTCAGGAGTGGG + Intergenic
1178480747 21:32977627-32977649 ATTTCAGGAAGGGCGGGGGTAGG - Intergenic
1179129485 21:38621854-38621876 ATTGCTGGAAAGGCATGAGTGGG - Intronic
1179352455 21:40625506-40625528 ACTCCAGAAAAGGCTGGAGAAGG - Intronic
1179442299 21:41403767-41403789 CCTTCAGCAAAGGCAAGAGAGGG + Intronic
1179836048 21:44034283-44034305 ACTTCACTACAGACAGGAGTGGG - Intronic
1180031378 21:45210814-45210836 GCTTCAGGAAAAGGAGGAGCTGG + Intronic
1180123651 21:45770874-45770896 TTTTCAGGAAGGGCAGGAGAGGG + Intronic
1180933677 22:19610398-19610420 ACATGAGGAGGGGCAGGAGTTGG - Intergenic
1181613220 22:24033587-24033609 ACGTCAGGGAGGGCAGGAGGAGG - Intronic
1181881679 22:25985521-25985543 ACTTTGGGAAAGGAAAGAGTTGG - Intronic
1182269634 22:29145317-29145339 ACTGCAGGAGAGGCAGGGGAGGG + Intronic
1184484062 22:44765616-44765638 ACCTCATGACAGGCAGGAGGGGG - Intronic
1184953669 22:47864750-47864772 ACTTCAGGAAAGGAAATAGAAGG + Intergenic
1185019056 22:48362947-48362969 ACCCCAGGGAAGGCAGGAGTAGG + Intergenic
1185222699 22:49636914-49636936 GCCTCAGGTGAGGCAGGAGTGGG - Intronic
1185330176 22:50248890-50248912 ACTACAGGCCAGGCCGGAGTGGG + Exonic
1185354859 22:50362121-50362143 GCTCCAGGAAGGGGAGGAGTCGG + Intronic
1185404169 22:50636879-50636901 ACTACAAGAAAAGGAGGAGTAGG + Intergenic
949528788 3:4933188-4933210 ACTTCTGGAATTTCAGGAGTGGG - Intergenic
950093193 3:10311936-10311958 ACTGCACGAAAGGCAGGGGATGG + Intronic
951220943 3:20068429-20068451 ACTTGAAGAAAGGTGGGAGTTGG - Intronic
952109657 3:30108196-30108218 ACTTCAGGAAAGGTGGGCATGGG + Intergenic
952338493 3:32425309-32425331 TCTCCAGGACTGGCAGGAGTGGG - Intronic
954491770 3:50913349-50913371 GCTTAAGGAAAGGAAAGAGTGGG - Intronic
954623275 3:52007741-52007763 ACTCGAGGAGAGGCAGGAGCTGG + Intergenic
954971776 3:54657160-54657182 TCTTCAGTTAAGGCAGGAATAGG + Intronic
956290230 3:67653731-67653753 ACTTCAGGAAAGTTTTGAGTTGG - Intronic
956699235 3:71944207-71944229 TCTTCAGGAAAGGCCTGTGTGGG - Intergenic
956772269 3:72536704-72536726 CCTCCAGGCAAGGCAGGAATGGG + Intergenic
960233314 3:115254332-115254354 ACTTCAGGAAAAGCTGGATCTGG + Intergenic
960509049 3:118526105-118526127 AGGTCAGGAAAGGCATCAGTTGG + Intergenic
960567369 3:119147734-119147756 ATTTCAGGAAGGGCAAGAGAAGG + Intronic
960882483 3:122359179-122359201 AATTCAGGAAAGGGAAGAGCAGG - Intergenic
961433028 3:126896743-126896765 ACCTCTGGAGGGGCAGGAGTGGG + Intronic
961561896 3:127736363-127736385 CTTCCAGAAAAGGCAGGAGTTGG + Intronic
961722544 3:128906398-128906420 ACTTCATGGAGGGCAGCAGTCGG - Intronic
963062117 3:141233558-141233580 ACTTAATGAAAGCCAGGAGAAGG - Intronic
963389947 3:144648523-144648545 ACTTCAGGAAATGCTGATGTTGG - Intergenic
963895656 3:150682879-150682901 AATTCAGGACAGGGAGGAGGAGG + Intronic
964956220 3:162359823-162359845 ATTTCAGGAAAAGTAGGAGCAGG - Intergenic
966129991 3:176626255-176626277 ACATCAGGAAAGACATGAGATGG + Intergenic
966740459 3:183228162-183228184 ACTTCAGTAAAGCTTGGAGTCGG + Intronic
967036897 3:185654823-185654845 TCTACAGGAAAGGCAGGTGACGG + Intronic
967562839 3:190936762-190936784 AATGAAGGAAAGGGAGGAGTGGG - Intergenic
968363599 3:198167678-198167700 ATTTCAGGACAGCCAGGAGGGGG + Intergenic
969474998 4:7417304-7417326 GCTCCAAGAAAGGCAGGACTTGG - Intronic
970504732 4:16716263-16716285 CCTTCAGCAAACCCAGGAGTGGG + Intronic
970572431 4:17395946-17395968 ACTTCAAGAAAGGGAGGGGTTGG - Intergenic
971264449 4:25085648-25085670 AATTGAGGAGAGGCAGGGGTGGG + Intergenic
972353677 4:38260516-38260538 GCTTGAGCAAAGGCAGGGGTGGG + Intergenic
975468313 4:74734819-74734841 ACAGAAGGAAAGGCTGGAGTTGG - Intergenic
976291494 4:83422765-83422787 AATACAGGAAAGGAAGGAATTGG + Intronic
976850517 4:89540202-89540224 GCTTCAGGAAAGGGAGGATGGGG - Intergenic
977316561 4:95456327-95456349 ACTGCAGGAAAGTCAGTTGTGGG + Intronic
977535241 4:98249768-98249790 ACTTTTGGAGAGGCAGGAGTGGG - Intergenic
978392957 4:108246678-108246700 AGTCAAGGAGAGGCAGGAGTTGG - Intergenic
978613717 4:110572145-110572167 ACACCAGGAATGGCAGCAGTGGG - Intergenic
980113874 4:128660586-128660608 ACATGGGGAAAGGCAGCAGTTGG + Intergenic
981207527 4:142060985-142061007 CTTTCAGGAAGAGCAGGAGTTGG + Intronic
982278969 4:153664725-153664747 ACTCCAGGAAAGAGAGGAGGAGG + Intergenic
983738223 4:171090737-171090759 ACTTTAGGATAAGCAGGAGGGGG - Intergenic
985893799 5:2737623-2737645 CCTACAGGACAGGCAGGAGATGG - Intergenic
987950659 5:24670597-24670619 ACTATAGGAAAGGCAGGAGTAGG + Intergenic
989050373 5:37314281-37314303 ACTTCAGGCAATTCAGCAGTTGG - Exonic
989267160 5:39488280-39488302 ACTTCTGGAATGGCAGTAGAAGG + Intergenic
989493975 5:42089971-42089993 TCTTCAAGAAAGGGTGGAGTTGG - Intergenic
990852771 5:60225637-60225659 AATTCAGCAAAGTGAGGAGTTGG - Intronic
991214436 5:64146156-64146178 AATACAGGAAAGGGAGGAGTAGG + Intergenic
991556163 5:67896991-67897013 ACTTCAGGAATGCAGGGAGTGGG + Intergenic
995953220 5:117742519-117742541 ACTTCATCATAGGCAGGAGTTGG + Intergenic
996761203 5:126987661-126987683 ACTTCAGGAAAGTCAGAGGGTGG + Intronic
996837891 5:127814168-127814190 ACGGCAGTAAGGGCAGGAGTGGG + Intergenic
999248032 5:150165936-150165958 ACTTCAGAAAAGCGGGGAGTAGG + Intergenic
999250477 5:150179579-150179601 TCGTCAGAAGAGGCAGGAGTGGG + Intronic
999635657 5:153619447-153619469 ACTTCAAGAAAGGGAGCAGATGG + Intronic
1001369411 5:171182199-171182221 CCTTCAAGAAAGGCGTGAGTAGG + Intronic
1002524393 5:179807117-179807139 GCCTCAGGTAAGGCTGGAGTGGG + Intronic
1004373045 6:15068961-15068983 ACCTCAGGAAATGCTGGAGACGG + Intergenic
1004612439 6:17256411-17256433 ACTTCAGGAATGGCAGAATAAGG - Intergenic
1005431168 6:25758260-25758282 ACTCCAGGAAAGAAAGGAGGAGG - Intronic
1006123470 6:31822023-31822045 ACATCAGAAAACGCAGGAGTCGG + Intergenic
1006534210 6:34684845-34684867 ACGCCAGGAAAGGTAGAAGTAGG + Intronic
1007065134 6:38982766-38982788 ACTTCTGAGGAGGCAGGAGTAGG - Intronic
1007805193 6:44438703-44438725 AGTTCTAGAAAGGCAGTAGTGGG - Intronic
1008646869 6:53523250-53523272 ACTTCAGGAAAAACAAAAGTAGG - Intronic
1009311110 6:62153920-62153942 ACTCCAGGATAGGCAGGTGGTGG - Intronic
1009393988 6:63176058-63176080 GCAACAGGAAAGGCAGGATTAGG - Intergenic
1010902210 6:81441695-81441717 ACATCAGGAATGGCAGTGGTGGG + Intergenic
1011716106 6:90106923-90106945 ACTTGAGGAAAGAGAGGAGGCGG - Intronic
1012668814 6:102014388-102014410 AGATCAGTGAAGGCAGGAGTGGG - Intronic
1014652295 6:124054672-124054694 AGATCAGCAAAGGAAGGAGTGGG + Intronic
1014700546 6:124681965-124681987 ATTACAGGAAAGGCAAGAGAAGG + Intronic
1015483793 6:133745617-133745639 ATTTCAGGGAAGGAAGGAGGAGG - Intergenic
1015507734 6:134006934-134006956 ACTAGAAGAAAGGCAAGAGTGGG + Exonic
1015932796 6:138378612-138378634 ACTTCAGGTAAGACAGCAGGGGG + Intronic
1017782013 6:157722601-157722623 CCTTAAGGATAGGCAGGAGGCGG + Intronic
1019252102 7:21005-21027 ATTTCAGGACAGCCAGGAGGGGG - Intergenic
1019413220 7:915652-915674 ACAACAGCAAAGGCAGGAATGGG + Intronic
1020678523 7:11208211-11208233 ACTTCAGGAAAGCCAGAAACAGG + Intergenic
1021020126 7:15587446-15587468 ACTGCAGTAAAGACAGGCGTAGG + Intergenic
1021239831 7:18186588-18186610 GCTTGAGGAATGTCAGGAGTGGG + Intronic
1021777835 7:24071229-24071251 AGTTGAGGAAAGGGAGGAGAGGG - Intergenic
1021864898 7:24945964-24945986 AATTCAGGAAAGGCTGGGCTGGG + Intronic
1022327898 7:29349244-29349266 ACTTCATGAAAGCCATGTGTAGG - Intronic
1022538182 7:31111157-31111179 AGTTCAGGAAAAGAAGGAATGGG - Exonic
1023965125 7:44960156-44960178 ACTTCAGGGAAGTCCAGAGTGGG - Intergenic
1026490723 7:70860990-70861012 CCTACAGAAAAGGCAGTAGTTGG + Intergenic
1027501718 7:78960185-78960207 ACTGCAGGAAAGGGATGTGTGGG + Intronic
1028904173 7:96134633-96134655 ATTTCAGGAAAGGAAGAAGAAGG - Intronic
1029019985 7:97354756-97354778 ACTATAGGGAAGGCAGAAGTGGG + Intergenic
1029351599 7:100016653-100016675 ACTGCAGGAAAGGGAGGGGAGGG - Intronic
1029468079 7:100738562-100738584 TCATCAGGAAAGCCAGGCGTGGG + Exonic
1030496547 7:110307819-110307841 ATTTCAGGAAAGGCAGAATTAGG + Intergenic
1030836001 7:114286579-114286601 ACATAAGGAAAGCCAAGAGTGGG + Intronic
1032688063 7:134256103-134256125 ACTACTGAAAAGGCAGGAGCAGG - Intronic
1032794263 7:135264908-135264930 ACTTCAGGATAGTGAGGAATGGG - Intergenic
1033187030 7:139237043-139237065 ACATCAGGAGAGGCAAGAGGTGG + Exonic
1033585319 7:142770577-142770599 ACTTAAGGAAGGGCAAGTGTTGG - Intergenic
1034564349 7:151901355-151901377 CCTTCAGGAAAGGGAGGGCTCGG + Intergenic
1034999789 7:155603600-155603622 ACAGCAGGAAAGGAAGGAGCTGG + Intergenic
1035942199 8:3913711-3913733 CATGCAGGGAAGGCAGGAGTGGG + Intronic
1036972627 8:13371727-13371749 AACTCAGGAAAGCCTGGAGTGGG - Intronic
1037578472 8:20230329-20230351 ATTTCAGGAAAGACAGGCTTGGG + Intergenic
1038084216 8:24175391-24175413 ACTTCAGGAAAGAAAGGTCTGGG + Intergenic
1038458696 8:27697337-27697359 ATTTCGGGAAATGCAGGCGTGGG - Intergenic
1042364202 8:67917693-67917715 ACTGAAGGACAAGCAGGAGTTGG - Intergenic
1043751227 8:83937693-83937715 GTTCCAGGAAAAGCAGGAGTGGG - Intergenic
1044130738 8:88521171-88521193 ACTTCACCAGAGGAAGGAGTAGG - Intergenic
1044323066 8:90827407-90827429 ACATAAGGAAAGGCAGGAGCTGG - Intronic
1044612710 8:94109757-94109779 ACTGCATGAATGCCAGGAGTTGG + Intergenic
1046860384 8:119085200-119085222 AATTCAGGATAGCCAGGAGTAGG + Intronic
1048634096 8:136276950-136276972 AATTCAGCAAAGGCAGTTGTTGG - Intergenic
1048649183 8:136455308-136455330 TCTTCAGGAAAGGTAGAGGTTGG - Intergenic
1049710031 8:144059300-144059322 TCTTCCGGAAACGCAGCAGTAGG + Intronic
1050675346 9:8045981-8046003 ACTAAAGGAAAGACAGGCGTAGG + Intergenic
1051487983 9:17629149-17629171 ACTTCATGGAAGGCAGAACTGGG - Intronic
1052656672 9:31371929-31371951 TGTTCAGGAAAGGCAGAAGCTGG - Intergenic
1053721507 9:40951477-40951499 TTTTCAGGAATGGCAGGAGGTGG - Intergenic
1056480942 9:87005293-87005315 ACTTCAAGGAATTCAGGAGTTGG + Intergenic
1057832822 9:98419871-98419893 AATTCAGCAGAGGCAGGAGCAGG + Intronic
1058178592 9:101768099-101768121 AATTAAAGAGAGGCAGGAGTAGG + Intergenic
1059081829 9:111258078-111258100 ATTTCAGTTAAGGCAGGAGGTGG + Intergenic
1059434035 9:114265860-114265882 ACCTCAGAAAGGGCAGGAGGAGG + Intronic
1060201317 9:121653080-121653102 ACTTCAGGAAAGGCAGGAGTGGG - Intronic
1060702373 9:125767895-125767917 ATTACATGAAAGGCAGGAGCAGG + Intronic
1060980329 9:127788192-127788214 TCTGCAGGAAGGGCAAGAGTGGG - Exonic
1061083855 9:128387904-128387926 GCTTCAGGGAAGGGAGGAGTGGG - Intronic
1061498408 9:130989005-130989027 ACCACAGGAAGGGCAGGAGGTGG - Intergenic
1062218216 9:135400395-135400417 AATGCAGGAAGGGCAGGAGCAGG - Intergenic
1062748239 9:138230910-138230932 ATTTCAGGACAGCCAGGAGGGGG + Intergenic
1185522032 X:747608-747630 ACCTCAGAAAAGGCAGGGATAGG + Intergenic
1186494482 X:10001282-10001304 CCTTCATGAAAGGGAGGAGTAGG - Intergenic
1186553083 X:10527634-10527656 GCTTCAGGCAAGGCAGGTGCTGG + Intronic
1187300448 X:18044083-18044105 TCCTCAGGAAAGGAAGGTGTGGG + Intergenic
1188061377 X:25606053-25606075 AGCTAAGGAAAGGCAGGTGTGGG - Intergenic
1189630034 X:42943062-42943084 ACCTCAGGAAAGGCAGGCAAAGG + Intergenic
1195128462 X:101831812-101831834 CCTTCGGGAAAGGGAGGGGTTGG + Intergenic
1195218212 X:102721282-102721304 GGATCAGGAAAGGCAGGGGTGGG + Intronic
1195634138 X:107094167-107094189 ACTTCAGAAAAGGGAAGAGAAGG + Intronic
1195803386 X:108736386-108736408 AATTCAGGAAAGGGAGGGTTGGG + Exonic
1196080745 X:111627974-111627996 GCATCAGGAAAGGCATGGGTTGG - Intergenic
1196466139 X:115973204-115973226 ACTTGAGGAGAGGGAAGAGTAGG + Intergenic
1196927233 X:120645558-120645580 AATTCAGGAAGGGGAGGAATAGG + Intergenic
1198507157 X:137312322-137312344 CCTTCTGGAAATGCTGGAGTGGG + Intergenic
1198836347 X:140808813-140808835 ACTGCAGGAAAGGCTGGGGTGGG - Intergenic
1199474126 X:148227463-148227485 ATTTGAAGCAAGGCAGGAGTTGG - Intergenic