ID: 1060202684

View in Genome Browser
Species Human (GRCh38)
Location 9:121660961-121660983
Sequence CCCACGAAGGAGAAGTCCAG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1060202678_1060202684 8 Left 1060202678 9:121660930-121660952 CCTGGAATTCTCACAGGATGGTA 0: 1
1: 0
2: 0
3: 7
4: 159
Right 1060202684 9:121660961-121660983 CCCACGAAGGAGAAGTCCAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1060202684 Original CRISPR CCCACGAAGGAGAAGTCCAG GGG Intronic
No off target data available for this crispr