ID: 1060202684 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 9:121660961-121660983 |
| Sequence | CCCACGAAGGAGAAGTCCAG GGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | Yes |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | No data | |||
| Summary | No data |
Found 1 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1060202678_1060202684 | 8 | Left | 1060202678 | 9:121660930-121660952 | CCTGGAATTCTCACAGGATGGTA | 0: 1 1: 0 2: 0 3: 7 4: 159 |
||
| Right | 1060202684 | 9:121660961-121660983 | CCCACGAAGGAGAAGTCCAGGGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1060202684 | Original CRISPR | CCCACGAAGGAGAAGTCCAG GGG | Intronic | ||
| No off target data available for this crispr | |||||