ID: 1060207589

View in Genome Browser
Species Human (GRCh38)
Location 9:121691309-121691331
Sequence TCCCCGGATGTCCCCACACT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 102
Summary {0: 1, 1: 0, 2: 1, 3: 12, 4: 88}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1060207589_1060207596 14 Left 1060207589 9:121691309-121691331 CCTAGTGTGGGGACATCCGGGGA 0: 1
1: 0
2: 1
3: 12
4: 88
Right 1060207596 9:121691346-121691368 AGACTGAGGAGGTACCTGAAGGG No data
1060207589_1060207597 19 Left 1060207589 9:121691309-121691331 CCTAGTGTGGGGACATCCGGGGA 0: 1
1: 0
2: 1
3: 12
4: 88
Right 1060207597 9:121691351-121691373 GAGGAGGTACCTGAAGGGTGTGG No data
1060207589_1060207595 13 Left 1060207589 9:121691309-121691331 CCTAGTGTGGGGACATCCGGGGA 0: 1
1: 0
2: 1
3: 12
4: 88
Right 1060207595 9:121691345-121691367 AAGACTGAGGAGGTACCTGAAGG No data
1060207589_1060207592 0 Left 1060207589 9:121691309-121691331 CCTAGTGTGGGGACATCCGGGGA 0: 1
1: 0
2: 1
3: 12
4: 88
Right 1060207592 9:121691332-121691354 GGCCTCTAAGAGAAAGACTGAGG No data
1060207589_1060207594 3 Left 1060207589 9:121691309-121691331 CCTAGTGTGGGGACATCCGGGGA 0: 1
1: 0
2: 1
3: 12
4: 88
Right 1060207594 9:121691335-121691357 CTCTAAGAGAAAGACTGAGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1060207589 Original CRISPR TCCCCGGATGTCCCCACACT AGG (reversed) Intronic
900390996 1:2433856-2433878 TCCACGGATGTGCCCACACTGGG + Intronic
900574332 1:3375568-3375590 TCCTGGTATGTCCCCAAACTCGG - Intronic
904419518 1:30382617-30382639 TCCCACTATGGCCCCACACTGGG - Intergenic
905268291 1:36770083-36770105 TCTCCAGATGTCCACACATTTGG + Intergenic
909761217 1:79289659-79289681 TCCCAGGATGACCCTGCACTAGG - Intergenic
912456635 1:109802609-109802631 GCCCTGGATGTCCCCAGCCTAGG - Intergenic
913053250 1:115135016-115135038 TCCCTCGGTCTCCCCACACTCGG - Intergenic
918175768 1:182043707-182043729 TCCCAGGTTGTACCCACACTAGG - Intergenic
922717879 1:227886538-227886560 TCCCCGGATGCTCCCTCCCTAGG + Intergenic
1068774715 10:60857379-60857401 TCCCTGGATGTCCCACCACAAGG - Intergenic
1076129346 10:128002102-128002124 GCCCCGGAGGTCCCCACAACTGG - Intronic
1076979144 11:195960-195982 TCCCCCTATGTCCCCTCACCAGG - Intronic
1082018935 11:47514898-47514920 TCCCCAAATGCCCACACACTGGG + Intronic
1083311065 11:61783998-61784020 TCTCCGGCTGTCCTCAGACTCGG - Intronic
1084694795 11:70746797-70746819 TGCCCCGCTGCCCCCACACTGGG + Intronic
1084753578 11:71220711-71220733 TCCATGGATTTCCCCACTCTAGG - Intronic
1086159986 11:83711339-83711361 TCCCAGCATTTCCCCTCACTTGG + Intronic
1089561210 11:119344131-119344153 TACCCAGATGTTCCCACACTGGG - Intronic
1091583613 12:1803418-1803440 TCCCCAGATGCGCCCACACCAGG + Intronic
1101844114 12:108348843-108348865 TGCCCCCATGGCCCCACACTTGG + Intergenic
1101936900 12:109065514-109065536 TCCCCACTTTTCCCCACACTGGG - Intronic
1101990189 12:109477736-109477758 TCGCCGGAGGTCCCCGCACTTGG - Exonic
1105967638 13:25399145-25399167 TACCCAGCAGTCCCCACACTGGG - Intronic
1107804527 13:44141734-44141756 TCCCCGGAGGTCCCGACGCCCGG + Intergenic
1110544389 13:76739756-76739778 TCCCCAGATGTCCCATCTCTTGG + Intergenic
1113024800 13:105928911-105928933 TCCCCGGATCACACCACACCAGG + Intergenic
1119406288 14:74401643-74401665 TCCCCGGCTGGCCCCTCCCTGGG - Intergenic
1121856091 14:97271443-97271465 ACCACGGATGGCCTCACACTTGG - Intergenic
1124661111 15:31551767-31551789 CCCTCGGATGTCCCCTCTCTGGG + Intronic
1125723578 15:41856834-41856856 TCCCCGGGTGGGCCCACACCTGG + Exonic
1128887732 15:71303856-71303878 TCCCAGGAGTTCCTCACACTAGG + Intronic
1132794469 16:1712647-1712669 TCCCCAGGTGGCCCCCCACTGGG + Intronic
1137580792 16:49632400-49632422 TCCCCAGGTGTGCCCACACAGGG + Intronic
1140509138 16:75494895-75494917 GCGGGGGATGTCCCCACACTCGG - Intronic
1143655552 17:8291485-8291507 CCCCCGGTCTTCCCCACACTAGG - Exonic
1145786768 17:27598752-27598774 TTCCCTGATGTCCCCAGATTGGG + Intronic
1150496166 17:65609461-65609483 CAGCCAGATGTCCCCACACTGGG - Intronic
1161794092 19:6376428-6376450 TCCCCTTGTGTCCCCACCCTTGG - Intronic
1161943258 19:7419025-7419047 ACCCCAGATGTACCCACACTCGG + Intronic
1161943265 19:7419055-7419077 ACCCCAGATGTACCCACACTCGG + Intronic
1161943272 19:7419084-7419106 TACCCTGATGTACCCACACTTGG + Intronic
1161943278 19:7419114-7419136 ACCCCAGATGTACCCACACTCGG + Intronic
1161943293 19:7419174-7419196 ACCCCAGATGTACCCACACTCGG + Intronic
1161943300 19:7419203-7419225 TACCCCGATGTACCCACACTCGG + Intronic
1161943307 19:7419232-7419254 TACCCCGATGTACCCACACTCGG + Intronic
1161943316 19:7419262-7419284 ACCCCAGGTGTGCCCACACTCGG + Intronic
1161943338 19:7419320-7419342 CACCCGGGTGTGCCCACACTTGG + Intronic
1162337943 19:10073207-10073229 CCCCAGGGTGACCCCACACTGGG - Intergenic
1162567530 19:11452690-11452712 TCCCCCGGTGTCCCCACGTTTGG - Exonic
1163720775 19:18897180-18897202 CCGCAGGATGTCCCCACACCTGG + Intergenic
1165008260 19:32823908-32823930 TCCCCCGAGGGCCCCACACCAGG - Intronic
1167602317 19:50461520-50461542 TCCCTCCCTGTCCCCACACTAGG + Exonic
1167666934 19:50827690-50827712 TTCCCTCATCTCCCCACACTGGG - Exonic
926726718 2:16004411-16004433 TCCCTGGATGTAGCCTCACTTGG - Intergenic
928928095 2:36598248-36598270 TCCCAGGCTGTCCCAACCCTGGG + Intronic
930019368 2:46992141-46992163 TCCCCGGATCACACCACACAAGG - Intronic
931670526 2:64643130-64643152 TCCCCGTCTGTCCCCGCACCAGG - Intronic
936506984 2:113115842-113115864 TCCCAGGTGGTCCCAACACTGGG - Intronic
939588343 2:144032533-144032555 TCCCAAGATGTCTCCACCCTTGG - Intronic
946026309 2:216673791-216673813 TCCCAGGATCTCCCCACCCTGGG + Exonic
948133079 2:235615207-235615229 TCCAGGGACGTCCCCACCCTCGG + Intronic
1173687903 20:44936990-44937012 TCCCCTGATCTCCCCACATCTGG - Intronic
1175851748 20:62097516-62097538 TTCCCGCCTGTCCTCACACTGGG + Intergenic
1175954623 20:62602937-62602959 TCCCCGGCTCTCCCCATTCTGGG + Intergenic
1176213100 20:63934969-63934991 TCACGAGATGTCCCCACAGTAGG - Exonic
1179997236 21:44979661-44979683 GCCACGGATAACCCCACACTTGG - Intergenic
1185101781 22:48844521-48844543 GCCCTGGAGGTCTCCACACTGGG - Intronic
950366489 3:12488867-12488889 TCACCCGATGCCACCACACTCGG + Intronic
954401976 3:50323732-50323754 TCCCCGGGGGTCCCCACCCATGG - Intronic
966923809 3:184631518-184631540 TCCCCGGATTTGCCCAATCTGGG - Intronic
967389691 3:188943372-188943394 TCCCCGGATGTGTCCTCTCTCGG - Intergenic
968818723 4:2834791-2834813 TACCCAGCTGTCCCCAGACTGGG - Exonic
981186652 4:141811437-141811459 TACCTGGTTTTCCCCACACTTGG + Intergenic
983717914 4:170808259-170808281 TCCCCAAATGCCCCCACAATAGG - Intergenic
985510885 5:313124-313146 TCCCAGGCTGTCCCCACCCTTGG + Intronic
985714326 5:1446838-1446860 TCCCTGTATCTCCCCACGCTAGG + Intergenic
986634068 5:9802346-9802368 TCCCAGGAAGTCCCAACCCTAGG + Intergenic
988900810 5:35730212-35730234 TCCCAGGATCTCCTCACATTTGG - Intronic
990488366 5:56280680-56280702 GCCCCATATGTCTCCACACTAGG + Intergenic
997269740 5:132526595-132526617 TCCCCCAAGGCCCCCACACTGGG - Intergenic
1000629120 5:163571909-163571931 TCCCCGGATCACACCAAACTTGG + Intergenic
1001288129 5:170438349-170438371 TGCCCTGCTGTCCCCACACGAGG - Intronic
1001711527 5:173782460-173782482 TGCCCTGAGATCCCCACACTTGG + Intergenic
1002421042 5:179149168-179149190 TTCCCGAAGGCCCCCACACTGGG - Intronic
1020136840 7:5592545-5592567 CCCCCGGATGTCCCCCACCTCGG - Intergenic
1024938691 7:54739866-54739888 TCCCTGCATCTCCCCACACAAGG + Intergenic
1030371244 7:108701694-108701716 TGCCCAGATATCCCCATACTTGG - Intergenic
1038506956 8:28092798-28092820 TCCCCGGATGTGACGACCCTGGG + Intronic
1038581249 8:28751066-28751088 TCCCCGGGGTTCCCCACACAGGG + Exonic
1040484236 8:47854993-47855015 GCCTCTGATGTCCCCACGCTGGG - Intronic
1043306911 8:78806262-78806284 TTTCCTGAAGTCCCCACACTGGG - Intergenic
1044118847 8:88368274-88368296 TCACCCCACGTCCCCACACTGGG + Intergenic
1049379068 8:142303028-142303050 TCCCCAGATGCCCACACACACGG - Intronic
1049534304 8:143171075-143171097 GACCCGGCTCTCCCCACACTGGG + Intergenic
1053210470 9:36223218-36223240 TCCCAGGAAGTCCCCATGCTTGG + Intronic
1058504177 9:105652246-105652268 TCCCAGGATGTCAACACAATCGG + Intergenic
1060207589 9:121691309-121691331 TCCCCGGATGTCCCCACACTAGG - Intronic
1061294123 9:129667691-129667713 TCCCTGGCTGTCCCCACAGCAGG - Intronic
1061827899 9:133273388-133273410 CCCCCAGATTTCCACACACTGGG + Intronic
1061975436 9:134066127-134066149 TCCCCGGATGTCCCAACGGCAGG + Intronic
1061980651 9:134101626-134101648 GCCCGGGATGCCCCCACACCGGG - Intergenic
1187238187 X:17487820-17487842 TCCCTGGCACTCCCCACACTGGG - Intronic