ID: 1060208910

View in Genome Browser
Species Human (GRCh38)
Location 9:121698901-121698923
Sequence CAAGCTCGGAGGCGGCAGGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1060208904_1060208910 -7 Left 1060208904 9:121698885-121698907 CCTCGCACGGGGAGGACAAGCTC 0: 1
1: 0
2: 0
3: 1
4: 57
Right 1060208910 9:121698901-121698923 CAAGCTCGGAGGCGGCAGGGAGG No data
1060208898_1060208910 19 Left 1060208898 9:121698859-121698881 CCTCCAGGTGGGTGTGGGGGGTG 0: 1
1: 0
2: 7
3: 47
4: 410
Right 1060208910 9:121698901-121698923 CAAGCTCGGAGGCGGCAGGGAGG No data
1060208899_1060208910 16 Left 1060208899 9:121698862-121698884 CCAGGTGGGTGTGGGGGGTGTGA 0: 1
1: 0
2: 6
3: 39
4: 428
Right 1060208910 9:121698901-121698923 CAAGCTCGGAGGCGGCAGGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1060208910 Original CRISPR CAAGCTCGGAGGCGGCAGGG AGG Intronic
No off target data available for this crispr