ID: 1060209016

View in Genome Browser
Species Human (GRCh38)
Location 9:121699207-121699229
Sequence CCGCGCGGCCGAGGGCGGGC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 431
Summary {0: 1, 1: 1, 2: 1, 3: 43, 4: 385}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1060209016_1060209031 8 Left 1060209016 9:121699207-121699229 CCGGCCCGCCCTCGGCCGCGCGG 0: 1
1: 1
2: 1
3: 43
4: 385
Right 1060209031 9:121699238-121699260 CAAGGGTGCGGGTCCCGCGCGGG 0: 1
1: 0
2: 1
3: 6
4: 63
1060209016_1060209032 14 Left 1060209016 9:121699207-121699229 CCGGCCCGCCCTCGGCCGCGCGG 0: 1
1: 1
2: 1
3: 43
4: 385
Right 1060209032 9:121699244-121699266 TGCGGGTCCCGCGCGGGTCCCGG 0: 1
1: 0
2: 0
3: 13
4: 111
1060209016_1060209026 -3 Left 1060209016 9:121699207-121699229 CCGGCCCGCCCTCGGCCGCGCGG 0: 1
1: 1
2: 1
3: 43
4: 385
Right 1060209026 9:121699227-121699249 CGGCCGCCCAGCAAGGGTGCGGG 0: 1
1: 0
2: 1
3: 14
4: 132
1060209016_1060209023 -9 Left 1060209016 9:121699207-121699229 CCGGCCCGCCCTCGGCCGCGCGG 0: 1
1: 1
2: 1
3: 43
4: 385
Right 1060209023 9:121699221-121699243 GCCGCGCGGCCGCCCAGCAAGGG 0: 1
1: 0
2: 0
3: 11
4: 86
1060209016_1060209025 -4 Left 1060209016 9:121699207-121699229 CCGGCCCGCCCTCGGCCGCGCGG 0: 1
1: 1
2: 1
3: 43
4: 385
Right 1060209025 9:121699226-121699248 GCGGCCGCCCAGCAAGGGTGCGG 0: 1
1: 0
2: 1
3: 17
4: 155
1060209016_1060209022 -10 Left 1060209016 9:121699207-121699229 CCGGCCCGCCCTCGGCCGCGCGG 0: 1
1: 1
2: 1
3: 43
4: 385
Right 1060209022 9:121699220-121699242 GGCCGCGCGGCCGCCCAGCAAGG 0: 1
1: 0
2: 1
3: 20
4: 180
1060209016_1060209030 7 Left 1060209016 9:121699207-121699229 CCGGCCCGCCCTCGGCCGCGCGG 0: 1
1: 1
2: 1
3: 43
4: 385
Right 1060209030 9:121699237-121699259 GCAAGGGTGCGGGTCCCGCGCGG 0: 1
1: 0
2: 1
3: 2
4: 89

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1060209016 Original CRISPR CCGCGCGGCCGAGGGCGGGC CGG (reversed) Intronic