ID: 1060209083

View in Genome Browser
Species Human (GRCh38)
Location 9:121699426-121699448
Sequence GAGCGCCGCCGCCGCCGCCG CGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 938
Summary {0: 1, 1: 3, 2: 35, 3: 226, 4: 673}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1060209079_1060209083 -2 Left 1060209079 9:121699405-121699427 CCACATCCTGCCGGGGTTCCGGA 0: 1
1: 0
2: 0
3: 8
4: 91
Right 1060209083 9:121699426-121699448 GAGCGCCGCCGCCGCCGCCGCGG 0: 1
1: 3
2: 35
3: 226
4: 673
1060209071_1060209083 26 Left 1060209071 9:121699377-121699399 CCAAGCTGGACCGCAACCACAGC 0: 1
1: 0
2: 0
3: 14
4: 145
Right 1060209083 9:121699426-121699448 GAGCGCCGCCGCCGCCGCCGCGG 0: 1
1: 3
2: 35
3: 226
4: 673
1060209080_1060209083 -8 Left 1060209080 9:121699411-121699433 CCTGCCGGGGTTCCGGAGCGCCG 0: 1
1: 0
2: 0
3: 7
4: 78
Right 1060209083 9:121699426-121699448 GAGCGCCGCCGCCGCCGCCGCGG 0: 1
1: 3
2: 35
3: 226
4: 673
1060209072_1060209083 16 Left 1060209072 9:121699387-121699409 CCGCAACCACAGCTTCCGCCACA 0: 1
1: 0
2: 0
3: 22
4: 321
Right 1060209083 9:121699426-121699448 GAGCGCCGCCGCCGCCGCCGCGG 0: 1
1: 3
2: 35
3: 226
4: 673
1060209077_1060209083 1 Left 1060209077 9:121699402-121699424 CCGCCACATCCTGCCGGGGTTCC 0: 1
1: 0
2: 2
3: 23
4: 276
Right 1060209083 9:121699426-121699448 GAGCGCCGCCGCCGCCGCCGCGG 0: 1
1: 3
2: 35
3: 226
4: 673
1060209073_1060209083 10 Left 1060209073 9:121699393-121699415 CCACAGCTTCCGCCACATCCTGC 0: 1
1: 0
2: 1
3: 36
4: 404
Right 1060209083 9:121699426-121699448 GAGCGCCGCCGCCGCCGCCGCGG 0: 1
1: 3
2: 35
3: 226
4: 673
1060209070_1060209083 27 Left 1060209070 9:121699376-121699398 CCCAAGCTGGACCGCAACCACAG 0: 1
1: 0
2: 0
3: 10
4: 135
Right 1060209083 9:121699426-121699448 GAGCGCCGCCGCCGCCGCCGCGG 0: 1
1: 3
2: 35
3: 226
4: 673

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1060209083 Original CRISPR GAGCGCCGCCGCCGCCGCCG CGG Exonic
900230643 1:1555310-1555332 GAGCTCCACCAGCGCCGCCGAGG - Intronic
900349526 1:2228118-2228140 GAGAGGCGCCTCCGCCGCCCCGG + Intergenic
900512975 1:3069053-3069075 CGCCGCCGCCGCCGCCGCCTCGG - Intergenic
901088336 1:6625438-6625460 TGGCGCCGCCGCGCCCGCCGCGG + Intronic
901243045 1:7705637-7705659 GAGCTCCGCGGGCCCCGCCGCGG - Intronic
901483174 1:9539848-9539870 GAGCGCCGGCGCCGTAGCCCGGG - Intronic
902323566 1:15684296-15684318 TCCTGCCGCCGCCGCCGCCGCGG + Intergenic
902350109 1:15847963-15847985 AGCCGCCGCCGCCGCCGCCCCGG + Exonic
903205994 1:21782989-21783011 GACCGCCGCAGCCGCCGCCGCGG + Exonic
903324742 1:22563451-22563473 CGCCGCCGCCGCCGCCGCCCCGG - Intergenic
903514737 1:23902841-23902863 CAGCAACGCCGGCGCCGCCGTGG - Intronic
903652326 1:24929787-24929809 TGCCGCCGCCGCCGCCGCAGGGG + Exonic
903875860 1:26472671-26472693 CACCGCCGCCGCCGCCTCCCTGG + Intronic
903883764 1:26529773-26529795 GCCGTCCGCCGCCGCCGCCGCGG - Intronic
903907516 1:26696877-26696899 GTCTGCCGTCGCCGCCGCCGCGG + Exonic
904181398 1:28668988-28669010 GCGTGCCGCCGCCGCCGCCGGGG + Intronic
904252931 1:29237667-29237689 GGGCCCCGCGGCCGCCGCCTCGG + Intronic
904620453 1:31772032-31772054 CCGCGCCGCCGCCGCCGCCACGG - Intergenic
904641988 1:31938059-31938081 CGCCGCCGCCGCCGCCGCCGAGG - Exonic
904782932 1:32964389-32964411 AGGCTCCGCCGCCGCCGCCGCGG + Exonic
904822829 1:33256455-33256477 CGCCGCCGCCGCCGCCGCCTCGG + Intergenic
905399697 1:37692354-37692376 CAGCGAGGCCGCCGCCGTCGCGG - Intergenic
905408486 1:37753207-37753229 CAGGGCCGCCGTCGGCGCCGCGG - Exonic
905449165 1:38046230-38046252 GGCCGCCGCCGCCGCCCCCCGGG + Exonic
905449285 1:38046642-38046664 CGCCGCCGCCGCCGCCGCCGCGG + Exonic
906204395 1:43979335-43979357 CGCCGCCGCCGCCGCCGCCGCGG - Intronic
906480949 1:46198469-46198491 CGCCGCCGCCGCCGCTGCCGCGG + Intronic
906637015 1:47416490-47416512 GGCCGCCGCCGCCGCCGCCCCGG - Exonic
906960920 1:50419099-50419121 CGCCGCCGCCGCCGCCGCCGGGG - Exonic
907053509 1:51345080-51345102 GGCCGCCGCCGCCGCCGCGAGGG - Exonic
907118651 1:51990388-51990410 GAGCCCCACCTCTGCCGCCGCGG + Intronic
908355811 1:63323939-63323961 GAGCGCCGCCGCAGCAGCCGCGG - Exonic
908355846 1:63324102-63324124 GGGCGCCGCCGCGGCCGCTGCGG + Exonic
908401130 1:63774053-63774075 AGCCGCCACCGCCGCCGCCGAGG + Exonic
910759003 1:90717598-90717620 CGCCGCCGCCGCCGCTGCCGGGG + Intergenic
910788001 1:91021666-91021688 GTGAGCGGCGGCCGCCGCCGCGG - Intronic
911114963 1:94237462-94237484 TACGGCCGCCGCCACCGCCGAGG + Exonic
911116046 1:94247612-94247634 TACGGCCGCCGCCACCGCCGAGG + Intronic
912246276 1:107964919-107964941 GGCCGCCGCCGCCGCCGCCGCGG + Exonic
912619519 1:111140564-111140586 GAGCGCCGGCGCGGGAGCCGGGG + Intronic
912670416 1:111619782-111619804 AGGCGCCGCCGCCGCTCCCGAGG + Exonic
913109064 1:115641862-115641884 TAGCGCTGCCGGCCCCGCCGCGG - Intergenic
913565562 1:120069428-120069450 CGCCGCCGCCGCCGCCGCCTGGG + Exonic
913615720 1:120558171-120558193 AGCCGCCGCCGCCGCCGCCTCGG - Intergenic
913632568 1:120724125-120724147 CGCCGCCGCCGCCGCCGCCTGGG - Intergenic
913979466 1:143497090-143497112 GCCCTCCGCCGCCACCGCCGCGG + Intergenic
914237334 1:145823950-145823972 CGTCGCCGCCGCCGCCGCCTCGG + Exonic
914286155 1:146228794-146228816 CTCCTCCGCCGCCGCCGCCGCGG + Exonic
914428602 1:147600196-147600218 CGCCGCCGCTGCCGCCGCCGGGG + Intronic
914574556 1:148952731-148952753 AGCCGCCGCCGCCGCCGCCTCGG + Intronic
914619316 1:149390799-149390821 CGCCGCCGCCGCCGCCGCCTGGG - Intergenic
914790930 1:150876678-150876700 GACCGCCGCCTCCGCTACCGCGG + Exonic
914808369 1:151008401-151008423 GAGCCCCGCCTCCGCCGCTGGGG + Intronic
914869123 1:151458819-151458841 GCGCGCCGCGGCGGGCGCCGGGG + Intronic
915246348 1:154558628-154558650 CGCCGCCGCCGCCGCCGCCGCGG + Exonic
916065505 1:161132641-161132663 CGCCGCCGCCGCCGCCGCCGCGG + Exonic
916065508 1:161132647-161132669 CGCCGCCGCCGCCGCGGCCGTGG + Exonic
917141569 1:171841142-171841164 CACCGCCGCCGCCACCACCGGGG - Intergenic
917345154 1:174022045-174022067 GAGCGGGGCTGCCGCGGCCGGGG - Intronic
917345182 1:174022158-174022180 GGCAGCCGCCGCCGCCGCCGAGG + Exonic
917755401 1:178093806-178093828 CACCGCCACCGCCACCGCCGTGG + Intergenic
917846692 1:179026018-179026040 GGCCGCCCCCGCCGCCTCCGGGG - Exonic
919712095 1:200738936-200738958 AGCCGCCGCCGCCGCCGCTGCGG - Intergenic
920260538 1:204685270-204685292 GGGCAGCGCCGCCGCCGCCGGGG - Intronic
920385631 1:205568900-205568922 AGGCGCCCCCGCCGCCGCCCGGG + Intronic
920705009 1:208244298-208244320 CGCCGCCGCCGCCGCCACCGCGG - Exonic
920881982 1:209888989-209889011 GAGCGCCGCCCCCTGCTCCGCGG - Intergenic
921024047 1:211260552-211260574 GAGCGCGGCCCTCGGCGCCGGGG - Intronic
922739340 1:228006810-228006832 GGGGGCCAACGCCGCCGCCGCGG + Intergenic
922753736 1:228082871-228082893 TGTCGCCGCCGCCGCCGCGGGGG - Intronic
922775436 1:228212353-228212375 GGGCGCTGCCAGCGCCGCCGCGG + Exonic
923163476 1:231337777-231337799 TATCGGCGCCGCAGCCGCCGCGG + Exonic
923171552 1:231421885-231421907 CGCCGCCGCCGCCGCCGCCATGG - Exonic
923461768 1:234214709-234214731 GAGCGCCGCCGCCTGCGTGGGGG + Intronic
923506347 1:234609468-234609490 GGCCGCCACCGCCACCGCCGCGG + Exonic
923684192 1:236142590-236142612 GGCCGCCGCCGCCCCCGCGGGGG - Exonic
923684195 1:236142593-236142615 CACGGCCGCCGCCGCCCCCGCGG - Exonic
924289724 1:242524715-242524737 CCCCGCCGCCGCCGCCGCCCCGG - Intergenic
924754786 1:246931492-246931514 CGCCGCCGCCGCCGCCGCCGCGG + Intronic
924754978 1:246932244-246932266 GCGCGCCGCCGGGGCCGCCAGGG - Intergenic
924835076 1:247639522-247639544 GCGCGCCTCTGCCGCAGCCGGGG - Intergenic
1064022877 10:11823626-11823648 GCCCGGCGCCGCCGCCGCAGAGG + Intronic
1064086506 10:12349650-12349672 CGCCGCCGCCGCCGCGGCCGCGG - Exonic
1064274197 10:13891771-13891793 CCCCGCCGCCGCCCCCGCCGCGG + Intronic
1064287999 10:14009628-14009650 GTGCGCTGCTGCCGCCGCCGTGG - Intronic
1064443172 10:15371242-15371264 CGCCGCCGCCGCCGCCGCCGCGG - Intergenic
1064622443 10:17229379-17229401 CCGCGCCACCGCCGCCGCCCAGG + Exonic
1064645374 10:17454334-17454356 CGCCGCCGCCACCGCCGCCGTGG + Intergenic
1064859773 10:19815553-19815575 GGTCCCCGCCGCTGCCGCCGCGG - Intergenic
1065023093 10:21516899-21516921 CGCCGCCGCCGCCGCCGCCTTGG + Exonic
1065140462 10:22714416-22714438 GCGCGCCGGGGCCGCCGCCGGGG - Exonic
1066370470 10:34815032-34815054 GAGCGCAGCCGGAGCAGCCGAGG + Exonic
1066464518 10:35640832-35640854 CACCGCCCCTGCCGCCGCCGCGG + Exonic
1068080660 10:52314262-52314284 CTGCGCCGCCACCGCCACCGCGG - Intergenic
1068617758 10:59138324-59138346 GGGCGCCGTCGCCACCTCCGCGG + Intergenic
1069438501 10:68407186-68407208 CCGCGCAGCCGCCGCCGCCATGG - Exonic
1069474572 10:68721393-68721415 GAGCCCCACCGTCGCCGCCCGGG - Intronic
1070257922 10:74826669-74826691 CACCGCTGCCGCCGCCGCCAGGG - Exonic
1070327638 10:75398982-75399004 CAGCGCTGCCGCGGCCGCCATGG - Exonic
1070570643 10:77637740-77637762 TGCCGCCGCCGCCGCCGCCGCGG + Intronic
1070800782 10:79243345-79243367 GGCCGCCGCCGCCGCCGCCGAGG - Intronic
1070800837 10:79243560-79243582 CCGCGCCGCCGCCGCCGCCGGGG + Intronic
1071086884 10:81875414-81875436 TGCCGCCGCCGCAGCCGCCGCGG - Exonic
1071332229 10:84571519-84571541 GAGCGCCGCCCCCTCCTCCAGGG + Intergenic
1071527469 10:86366664-86366686 AAGCGCCGCTGCCACAGCCGCGG - Intergenic
1071997519 10:91162877-91162899 CAGCGCCGCCGCCGCCGCCGCGG + Intergenic
1072059736 10:91798467-91798489 TCGCGCTGCCTCCGCCGCCGCGG + Exonic
1072059816 10:91798732-91798754 GAGCGCCGCGGCCGAGGCCGTGG + Exonic
1072562232 10:96586897-96586919 CGCCGCCGCCGCCTCCGCCGCGG + Exonic
1072719501 10:97771932-97771954 AGCCGCCGCCGCCGCCGCCGCGG + Exonic
1072719503 10:97771935-97771957 CGCCGCCGCCGCCGCCGCGGAGG + Exonic
1072891520 10:99329398-99329420 CACCGCTGCTGCCGCCGCCGCGG - Exonic
1073051654 10:100671116-100671138 GAGACCCGCCGCCTCCGCCGGGG + Intergenic
1073059431 10:100724549-100724571 GAGCCTGGTCGCCGCCGCCGCGG - Intergenic
1073099604 10:100999792-100999814 CAGCCCCGCCTCCGCCTCCGCGG - Exonic
1073266369 10:102230681-102230703 CTCGGCCGCCGCCGCCGCCGCGG - Exonic
1073325844 10:102643729-102643751 GAGGCCCGGCGCCCCCGCCGCGG - Intergenic
1073789722 10:106928143-106928165 GAGCGCCGCCGCCTGCTCCACGG - Intronic
1074995494 10:118754462-118754484 CTGCGACGCGGCCGCCGCCGTGG - Exonic
1075645454 10:124093304-124093326 GCGCGCCGCCTCCGCCGGCCCGG + Intronic
1075748485 10:124744224-124744246 GCCCGCACCCGCCGCCGCCGCGG + Intronic
1075999775 10:126905496-126905518 TGGCGCCGCCGGAGCCGCCGCGG - Exonic
1076548250 10:131260370-131260392 CACCGCCGCCGCCGCTGCCATGG - Exonic
1076554209 10:131311519-131311541 AGCCGCCGCCGCCGCCGCCCTGG - Exonic
1076638912 10:131901018-131901040 CGCCGCCGCCGCCGCCGCCGGGG - Exonic
1076792811 10:132785949-132785971 GGGCGCCGCCGCCGCCGGCCCGG + Exonic
1076876408 10:133218346-133218368 GAGTGCCGCCCCCTCCTCCGGGG - Intronic
1077214546 11:1389998-1390020 CGCCGCCGCCGCCGCCGCCGAGG - Intronic
1077674967 11:4187455-4187477 TCGCGCTGCCGCCGCCGCCGCGG - Intergenic
1077962405 11:7089453-7089475 GCGGGCCGCCGCCACCCCCGCGG - Exonic
1078091785 11:8268564-8268586 GAGAGCCGCGACCGCCGACGGGG + Intronic
1078222628 11:9364359-9364381 GAGCGCCGCTGACGCCGGAGCGG + Intergenic
1078659824 11:13277857-13277879 ACTCACCGCCGCCGCCGCCGCGG + Exonic
1079163168 11:18012960-18012982 GAGCGCGGCCGCCGCGGGGGCGG + Exonic
1079237104 11:18698868-18698890 AGCCGCCGCCGCCGCCGCCATGG + Exonic
1079689405 11:23403534-23403556 CCGCGCCGCCGCCGCCGCCGCGG + Intergenic
1080283600 11:30585391-30585413 GCGCCCCGCGGCCGCCCCCGGGG - Intronic
1080802100 11:35618651-35618673 GCGGGGCGCCGCCGCCACCGCGG + Exonic
1081465392 11:43312062-43312084 GACCGGCGCCACCGCCGCCTCGG - Exonic
1082986080 11:59172361-59172383 GCGCGCCGCCGCCGCCGCCGGGG - Intronic
1083623650 11:64060936-64060958 CCCCGCCGCCGCCGCCGCCGCGG - Intronic
1083970302 11:66070403-66070425 CGCCCCCGCCGCCGCCGCCGCGG + Intronic
1083970307 11:66070406-66070428 CCCCGCCGCCGCCGCCGCGGGGG + Intronic
1084129034 11:67119339-67119361 CGCCGCCGCCGCCGCTGCCGGGG - Intronic
1084192195 11:67504356-67504378 CACCGCCGCCCGCGCCGCCGGGG + Intronic
1084310286 11:68312722-68312744 CAGCGCCGCCCGGGCCGCCGTGG + Exonic
1084546851 11:69818952-69818974 GCCTGCAGCCGCCGCCGCCGCGG - Exonic
1084758303 11:71252532-71252554 GAGCTCAGGAGCCGCCGCCGCGG + Intronic
1085044040 11:73343205-73343227 GGGCCCAGCCGCCGCCTCCGGGG + Intronic
1085485667 11:76860952-76860974 CGCCGCCGCCGCCGCCGCCCAGG - Exonic
1086110649 11:83194566-83194588 GAGGGCCGCTGCCGCTGCAGTGG + Exonic
1086341784 11:85854968-85854990 GAGCGCCCGCGCCGCCGCCTTGG - Intergenic
1086887838 11:92224978-92225000 CGCCGCCGCCGCCGCCGCCGGGG - Intergenic
1088481067 11:110296704-110296726 GAGCGCCAACGCCGCCGCTGGGG + Exonic
1089432715 11:118436697-118436719 GCTTCCCGCCGCCGCCGCCGCGG - Exonic
1089560300 11:119340223-119340245 GCGCGCCGTCGCGGCCGTCGCGG + Exonic
1089622332 11:119729030-119729052 GAGCCCCGCGCCCGCCGCCTGGG - Exonic
1089700250 11:120240228-120240250 GTTCCCGGCCGCCGCCGCCGCGG - Intronic
1089730671 11:120516907-120516929 GAACGCAGCAGCCGCCGCCCAGG - Intronic
1089993427 11:122882898-122882920 CGCCGCCGCCGCCGCCGCCCGGG - Exonic
1090699312 11:129279630-129279652 GAGGCGCGCCGCCGCGGCCGCGG + Intergenic
1090788471 11:130069992-130070014 GACCGCGGCCGCCGCAGCCACGG + Exonic
1090978389 11:131695031-131695053 GAGCGCCGCCGCCGCCGGGAGGG + Intronic
1091498322 12:991332-991354 CCGCGCTGTCGCCGCCGCCGCGG - Intronic
1091550289 12:1530984-1531006 CGCCGCCGCCGCCGCCGCCCCGG + Intronic
1091558582 12:1594165-1594187 CGCCGCCGCCGCCGCCGCCTCGG + Exonic
1091558654 12:1594365-1594387 GCCGGCCGCCGCCGCCGCCTCGG + Intronic
1091616231 12:2053054-2053076 AAGAGCCGCCGCCGCCGCTCCGG - Intronic
1091823164 12:3491292-3491314 GACCGCCGCCGCCGCCGCCGCGG + Exonic
1091823166 12:3491295-3491317 CGCCGCCGCCGCCGCCGCGGAGG + Exonic
1092256311 12:6928244-6928266 GGCCGCCGCCGCCGTCGTCGCGG + Intronic
1092796044 12:12111058-12111080 GCGCGCCTCCTCCGCCGCCGCGG + Intronic
1094041121 12:26122641-26122663 CGCCGCCGCTGCCGCCGCCGCGG + Exonic
1094564937 12:31590853-31590875 GGCCGCCGCCGCCGCCGCCCGGG + Exonic
1096191342 12:49622239-49622261 GCGGCCCGCAGCCGCCGCCGCGG - Intronic
1096372883 12:51083444-51083466 GAGCTCCCCGGCCGTCGCCGCGG - Exonic
1096622688 12:52874336-52874358 GGGCGCGGCCGGCGCCGCCCTGG - Intergenic
1096983740 12:55743399-55743421 CGCCGCCGCCGCCGCCGCCGCGG - Exonic
1097232859 12:57522866-57522888 AAGCGCCGCTGCCGCCGCCGCGG - Exonic
1097264420 12:57737514-57737536 CGCCACCGCCGCCGCCGCCGGGG - Exonic
1097929670 12:65169965-65169987 GGGCGCCTCCGCCGCCCCCGCGG + Exonic
1097990336 12:65825883-65825905 GCGCGCCGCAGCCGCCCCCTTGG + Intronic
1098255488 12:68611256-68611278 AGGAGCAGCCGCCGCCGCCGCGG + Intronic
1098426061 12:70366537-70366559 CGCTGCCGCCGCCGCCGCCGGGG + Exonic
1100315623 12:93441988-93442010 CGTCGCCGCAGCCGCCGCCGAGG + Exonic
1100391734 12:94150076-94150098 GGGAGCCGCCGCCGCCGCCGAGG + Intronic
1100444814 12:94650579-94650601 GCCCTGCGCCGCCGCCGCCGCGG + Intergenic
1101592898 12:106139193-106139215 CGCCGCCGCCGCCGCCGCCGTGG - Exonic
1101605885 12:106247623-106247645 CGCCGCCGCCGCCGCCGCCGCGG + Exonic
1101605887 12:106247626-106247648 CGCCGCCGCCGCCGCCGCGGTGG + Exonic
1102277958 12:111598117-111598139 GGGAGCCCCCGCCGCCGCCTCGG + Intronic
1102370948 12:112382090-112382112 CGCCGCCGCCGCCGCCGCCGCGG + Exonic
1102678075 12:114672066-114672088 GGGCCCCGCGGCCGCCGCCATGG + Exonic
1102853864 12:116277234-116277256 CCGGGCCGCCGCCGCCGCCGGGG + Exonic
1102853955 12:116277497-116277519 CGGAGCCGCCGCCGCCGCCTCGG + Intergenic
1103325436 12:120116983-120117005 GAGCGTCGTCGCCGCCACCCTGG + Intronic
1103410842 12:120710503-120710525 GGGCCCAGCCGCCGACGCCGCGG - Exonic
1103433026 12:120904104-120904126 CGGAGCCGCCGCCGCCGCCGCGG - Exonic
1103521249 12:121537912-121537934 AGCCGCCGCCGCCGCCGCCGAGG - Intronic
1103563596 12:121804671-121804693 AGCGGCCGCCGCCGCCGCCGCGG + Intronic
1103563597 12:121804674-121804696 GGCCGCCGCCGCCGCCGCGGCGG + Intronic
1103649635 12:122422628-122422650 GTGACGCGCCGCCGCCGCCGCGG + Intronic
1103828733 12:123762220-123762242 CAGCGCCGGCGCCGTCGGCGGGG + Intergenic
1103954250 12:124567588-124567610 CACCGCCGCCGCGGCCGCCGGGG - Intronic
1103954256 12:124567597-124567619 CGCCGCCGCCACCGCCGCCGCGG - Intergenic
1104049562 12:125186488-125186510 CCCCGCCGCCGCCGCCGCCGCGG - Intergenic
1104444710 12:128823854-128823876 GAACGCCCCAGCCGCCGCCGCGG + Exonic
1104448851 12:128853563-128853585 GCATGCCGCCGCCGCCGCCCGGG - Exonic
1106208405 13:27620500-27620522 CGCCGCCGCCGCCGCCGCCGCGG + Intergenic
1106304100 13:28495051-28495073 CCGAGCCGCCGCCGCTGCCGGGG + Exonic
1106322963 13:28659272-28659294 TGCCGCCGCCGCCGCCACCGGGG - Intronic
1106422479 13:29595415-29595437 GAGCCCCGCCGCCGCCGGCTTGG - Exonic
1106516957 13:30464707-30464729 CTGCGCCGCCGCCGCCGCGAGGG + Intronic
1106683429 13:32031520-32031542 CAGCGCGGCCGCCGCCTCCGAGG + Exonic
1106735836 13:32586914-32586936 GCCCGCCGCCGCCGCCGCCCCGG - Intronic
1107078250 13:36346481-36346503 GCACGCCGCCGCCGCAGCCTAGG + Exonic
1107467833 13:40665900-40665922 GGCCGCCGCGGCCGCCACCGGGG - Exonic
1107604014 13:42040754-42040776 GGCCGCCGCCGCCGCCGCCCCGG - Intronic
1108227457 13:48303945-48303967 CACCGCCGCCGCTGCCGCCGCGG + Exonic
1108408133 13:50124708-50124730 GAGCGCCCGCCGCGCCGCCGTGG - Intronic
1110705921 13:78602143-78602165 GGCCGCCGCCGCCGCCCCCCGGG + Exonic
1110705950 13:78602197-78602219 CCGGGCCGCCGCCGCCGCCCGGG + Exonic
1110965488 13:81689963-81689985 GCGCGCCTCCTCCGCCGCCGCGG + Intergenic
1111951318 13:94711551-94711573 TGCCGCCGCCGCCGCCGCCGCGG - Exonic
1112507198 13:99982135-99982157 AGCCGCCGCCGCCGCCGCGGCGG - Exonic
1112507199 13:99982138-99982160 GGCAGCCGCCGCCGCCGCCGCGG - Exonic
1112652759 13:101416509-101416531 GAGCGCCGCCGCCGCCGGGCAGG + Intergenic
1113200999 13:107867343-107867365 GCCCGCGGGCGCCGCCGCCGGGG + Intergenic
1113378529 13:109784442-109784464 CACCGCCGCCGCCGCCGTCTCGG + Exonic
1113656099 13:112068501-112068523 GGCCGCCGCCGCCGCCGCTGCGG + Exonic
1113656115 13:112068545-112068567 CGCCGCCGCCGCCGCCGCCACGG - Exonic
1113742116 13:112718486-112718508 GAGGGCAGCCGCCTCCGCTGGGG + Intronic
1114612521 14:24052102-24052124 AGGAGCCGCCGCCGCCGCCGGGG - Exonic
1115399235 14:32939123-32939145 CGCCGCCGCCGCCGCCGCCACGG + Intronic
1115399317 14:32939415-32939437 CGCCGCCGCCTCCGCCGCCGAGG + Intronic
1116003261 14:39266879-39266901 TCTCGCCGCCGCCGCCACCGCGG + Intronic
1116817862 14:49599795-49599817 CCGCGGCGCTGCCGCCGCCGCGG - Intronic
1116905093 14:50396643-50396665 AAGCCTCGCCGCCGCCTCCGCGG - Intronic
1117176687 14:53153029-53153051 AGGCGCCGCCGCCGCCGCCTCGG + Exonic
1117302293 14:54441427-54441449 GACCGCCACCGCTACCGCCGCGG + Exonic
1117315112 14:54565991-54566013 GCGTGCCGTCGCCGCCGCCCGGG + Intergenic
1117803143 14:59465101-59465123 GAGCACGGCCGCCGTGGCCGCGG + Exonic
1117875880 14:60249584-60249606 GGCTGCCGCCGTCGCCGCCGCGG + Intronic
1117875893 14:60249620-60249642 GGCTGCCGCCGCCGCCGCCTCGG + Intronic
1117875930 14:60249724-60249746 GCCCGCCGCCGCCGCCGCGCAGG - Intronic
1118220693 14:63852873-63852895 GAGCGCGCCCGCCAGCGCCGGGG - Intergenic
1118299361 14:64601658-64601680 GAGTGCAGCGGCGGCCGCCGAGG - Intergenic
1118351002 14:64972369-64972391 CTGCGCCGCCGCCGCCGCCCCGG + Intronic
1118607700 14:67515405-67515427 CGCCGCCGCCGCCGCCGCCGGGG - Intronic
1118752425 14:68816679-68816701 GAGCTCAGCCGCCGCAGCCCCGG - Intergenic
1118849479 14:69573085-69573107 CGCCGCCGCCGCCGCCGCCGCGG - Exonic
1118971506 14:70641918-70641940 AGCCGCCGCCGCCGCCGCCTCGG - Exonic
1118971596 14:70642222-70642244 GGGCTCCTCCGCCGCCGCCCGGG - Exonic
1119484916 14:74980924-74980946 CCGCGCCGCCGCCGCCACCGTGG - Intergenic
1119743212 14:77027300-77027322 CGCCGCCGCCGCCGCCGCTGCGG - Exonic
1121050438 14:90816329-90816351 AGGCCCCACCGCCGCCGCCGCGG + Exonic
1121767797 14:96502530-96502552 AACCGCCGCCGCTGCCGCCCTGG - Exonic
1122130812 14:99603927-99603949 CGCCGCCGCCGCCGTCGCCGCGG + Exonic
1122221037 14:100239216-100239238 GGGCTCCGCCGCCACGGCCGCGG - Exonic
1122444991 14:101761696-101761718 CGCCGCCGCCGCCGCCGCCGTGG + Intergenic
1122445014 14:101761778-101761800 CGCCGCCGCCGCCGCCGCCCGGG - Exonic
1122786143 14:104164132-104164154 CAGCGCTGCAGCCGCCGCAGTGG + Intronic
1122993283 14:105248924-105248946 CAGCAACGCCGGCGCCGCCGTGG + Exonic
1123024887 14:105419881-105419903 CGCCGCCGCCGCCGCCGCCGAGG - Exonic
1202899776 14_GL000194v1_random:28356-28378 CAGCGCCGGCGCAGGCGCCGGGG - Intergenic
1123799192 15:23803236-23803258 GAGCGCCGCCGCCTGCTCCAGGG + Intergenic
1124128911 15:26967868-26967890 GGGTCCCGCCGCCCCCGCCGAGG + Intergenic
1124427010 15:29570844-29570866 GCGCGCGGCCGCCGCAGCCCTGG - Intergenic
1124453700 15:29821977-29821999 GAGCGCCTCCGCGGCCGCCAGGG - Intronic
1124652506 15:31484004-31484026 CGCCGCCGCCGCCGCCGCCACGG - Exonic
1125508788 15:40282031-40282053 CCGCGCCGCCGCCGCCGCTGCGG - Exonic
1125522938 15:40358259-40358281 CGCCGCCGCCGCCGCCGCCGCGG + Exonic
1125647378 15:41283949-41283971 AAGCCCCGCCCCCGCCGCTGGGG - Intergenic
1125674246 15:41494059-41494081 GGTCGCTGCGGCCGCCGCCGCGG + Exonic
1126849868 15:52790365-52790387 CGCCGCCGCCGCCGCCGCAGCGG + Intronic
1128067853 15:64775591-64775613 TGCCGCCGCCGCCGCCGCCGCGG - Intergenic
1128830404 15:70763329-70763351 TGGCGCCGCCGCCGCCAGCGCGG - Exonic
1129260766 15:74365983-74366005 TGGGGCCGCCGCCGCCTCCGCGG + Intronic
1129541141 15:76347459-76347481 GATCGGCGCCCCCGCCACCGCGG - Intergenic
1129823645 15:78620591-78620613 GAGGGCTGGCGCCGTCGCCGGGG - Intronic
1130076689 15:80695612-80695634 GGCTACCGCCGCCGCCGCCGCGG + Exonic
1130115303 15:81000956-81000978 GCTCGCCGCCGCCGCCGCCTCGG - Exonic
1130348015 15:83066896-83066918 TCGCGGCGCCGCCGCCGCTGGGG - Exonic
1132079490 15:98852345-98852367 CCGCGCCCGCGCCGCCGCCGTGG + Intronic
1132365126 15:101251565-101251587 GGGCAGCGCCGCCGCCGCCGCGG + Exonic
1132585806 16:705395-705417 GGGCCGCGCCGCCGCCGCCCGGG - Intronic
1132641876 16:981780-981802 CGCCGCCGCCGCCGCCGCCGAGG - Intergenic
1132650498 16:1019401-1019423 CAGCGCGGCCGCCGCTCCCGTGG - Intergenic
1132793377 16:1706197-1706219 CTCCGCCGCCGCCGCTGCCGAGG - Exonic
1132877959 16:2148664-2148686 CGCCGCCGCCGCCGCCGCCAGGG + Exonic
1133156559 16:3880444-3880466 CGGGGTCGCCGCCGCCGCCGCGG + Exonic
1133188392 16:4116159-4116181 GTGCGCCGCCGCTCCCGCCGCGG + Exonic
1133784352 16:8963358-8963380 CGCCGCCGCCGCCGCCGCCCCGG - Exonic
1133784410 16:8963566-8963588 GGCCGCCGCCGCCGCCGCCGCGG + Intronic
1133784517 16:8963816-8963838 GAGCCCCGACGACGACGCCGAGG - Intronic
1134149697 16:11796589-11796611 GGGCGGCGCCCCCGCCTCCGCGG + Intronic
1134163958 16:11915573-11915595 GGGAGCCGCCGCCGCCGCAAGGG + Exonic
1134441667 16:14302517-14302539 CACCGCCGCTGCCGCCTCCGGGG - Intergenic
1135517670 16:23149156-23149178 CCGCGCCGCCGCCGCCAGCGCGG + Exonic
1135691318 16:24539913-24539935 CCCCGCCGCCGCCGCCGCCTCGG - Intronic
1135821736 16:25691922-25691944 GCGCGCGCCCGGCGCCGCCGAGG - Intergenic
1136365176 16:29806409-29806431 CGCCGCCGCCGCCGCCGCCCGGG + Intronic
1136365216 16:29806483-29806505 CGTCGCCGCCGCCGTCGCCGCGG + Intronic
1136498733 16:30659327-30659349 GGGAGCCGGCGCCGCCCCCGGGG - Exonic
1136556496 16:31010496-31010518 GGGCGCCGCGGCCGCTGCGGGGG + Exonic
1136626353 16:31464550-31464572 CAGCCCCGCCGCCGCCATCGAGG + Exonic
1136861550 16:33707235-33707257 CCGCGCCTGCGCCGCCGCCGTGG + Intergenic
1136867777 16:33770536-33770558 TGCCGCCGTCGCCGCCGCCGCGG + Intergenic
1137531527 16:49281569-49281591 CAGCTCCGCCGCCGCCGCTCTGG + Exonic
1137708015 16:50548611-50548633 CCCCGCCGCCGTCGCCGCCGCGG + Intronic
1137988577 16:53130808-53130830 GACCGCCGCCGCTCCTGCCGCGG - Intronic
1138105709 16:54286209-54286231 CGCCGCCGCCGTCGCCGCCGCGG - Exonic
1138478289 16:57284712-57284734 CGGCTCCGCCCCCGCCGCCGGGG + Intergenic
1138590433 16:57996552-57996574 CAGTGCCGCCGCCGCGGCAGCGG - Exonic
1139364829 16:66427042-66427064 GAGCCGCGCCGCCGCCGAGGGGG + Intergenic
1139534452 16:67562810-67562832 CGGCGCCAGCGCCGCCGCCGGGG + Intronic
1139615365 16:68085387-68085409 AGTCGCCGCCACCGCCGCCGCGG - Intronic
1140187428 16:72787742-72787764 CACCGCCGCCGCCGCCGGTGGGG + Exonic
1140209183 16:72957815-72957837 CACCGCCGCCGCCGCCGCCCCGG + Exonic
1140927657 16:79599413-79599435 GATGGGCCCCGCCGCCGCCGTGG - Exonic
1141054612 16:80804011-80804033 GGCCGCCGCCGCCGCCGCCGCGG + Intronic
1141079180 16:81035878-81035900 CGCCGCCGCCGCCGCCTCCGAGG - Exonic
1141079201 16:81035951-81035973 AGGAGCCGCCGCCGCCGCCTCGG + Exonic
1142130739 16:88430509-88430531 GAGAGCCGCCGCCCTCCCCGAGG + Exonic
1142163333 16:88570625-88570647 GGCCGCCGCCGCCGCCTCGGCGG - Intronic
1142171262 16:88624032-88624054 GAGAGCCGGCCCCGCCGCCCGGG + Exonic
1142552813 17:751593-751615 GAGCGCAGCCGCCCCCACCGCGG + Intronic
1142741838 17:1936157-1936179 GAGCCCCGGTGCCGCCGTCGGGG + Exonic
1142762421 17:2050232-2050254 GGCCGCCGCCGCCGCGCCCGGGG - Intergenic
1142764667 17:2058481-2058503 GGGCGCGGCCGGCGCGGCCGGGG + Exonic
1143099879 17:4499111-4499133 GAGCGGCGGCGCCGGCGCCGGGG + Exonic
1143584280 17:7843676-7843698 GAGCGCTGGCCCCGCCCCCGCGG + Intronic
1143708620 17:8718166-8718188 GAGCCTCCCCGCCGCCACCGTGG - Intergenic
1144185136 17:12789724-12789746 CAGTGCCGCCGCCGTCGCCCGGG + Exonic
1144547997 17:16215477-16215499 TCCAGCCGCCGCCGCCGCCGCGG + Exonic
1144910058 17:18673038-18673060 CGCCGCCGCCGCCGCCGCCTGGG + Exonic
1145925655 17:28644952-28644974 CGCCGCCGCCGCCGCCGGCGCGG + Intronic
1146057698 17:29589437-29589459 AGGGGCCGCCGCCGCCGCCCGGG - Exonic
1146219839 17:31008727-31008749 GCCCGCCGCCTCCGCCGCTGGGG + Intergenic
1146956057 17:36936904-36936926 GACCGCCGCTGTCGCCGCCCGGG - Intronic
1147200630 17:38799380-38799402 CGGCGCCACCGCCACCGCCGTGG + Exonic
1147200647 17:38799427-38799449 CGCCGCCGCCGCCGCCGCCCCGG - Exonic
1147325405 17:39667485-39667507 GAGGGCCGCCGGGGCCACCGGGG - Intergenic
1147719826 17:42532207-42532229 CGCCGCCGCCGCCGCCGCCCAGG + Intergenic
1147720441 17:42536470-42536492 GCGCCGCGCCGCCGCCGCCCAGG - Exonic
1148388628 17:47254187-47254209 GAGCGCCTTCCCGGCCGCCGCGG + Intronic
1148579374 17:48733219-48733241 GAGCGCGGCCGCCGCGCCCCCGG + Intergenic
1148698695 17:49575886-49575908 GAGCGGCGCCGCTGGAGCCGAGG + Exonic
1148852199 17:50560814-50560836 TGCCGCCGCCGCAGCCGCCGCGG - Intergenic
1148878572 17:50707714-50707736 CAGCGCCGCCGCCGTCGCCGCGG + Exonic
1149430557 17:56593491-56593513 AGCCGCCGCCGCCGCCTCCGCGG + Intergenic
1149461539 17:56833694-56833716 TGCCGGCGCCGCCGCCGCCGGGG - Exonic
1149994616 17:61400093-61400115 GCGCGCCGCCGCCCGGGCCGGGG + Exonic
1149994707 17:61400361-61400383 TGCTGCCGCCGCCGCCGCCGCGG - Exonic
1150003656 17:61456649-61456671 CGTCGTCGCCGCCGCCGCCGCGG + Exonic
1150373505 17:64661883-64661905 CCCCGCCGCCCCCGCCGCCGGGG - Exonic
1150423167 17:65056596-65056618 TGCCGCCGCCGCCGCCGCCTCGG + Exonic
1150791919 17:68205834-68205856 GTGGGCCGCCGCCGCCGCCTAGG + Intergenic
1151537858 17:74748849-74748871 GAGCGCGGACGCAGCGGCCGGGG + Exonic
1151662333 17:75525565-75525587 GAGCGCAGCCCCCACCCCCGAGG + Intronic
1151755335 17:76072449-76072471 CGCCGCCGCCGCCGCCGCCTGGG + Exonic
1151866461 17:76806387-76806409 GAGCCTCCCCGCCCCCGCCGTGG + Intergenic
1152049141 17:77958950-77958972 CGCCGCCGCCGCCGCCGCCTAGG + Intergenic
1152049235 17:77959235-77959257 CGGAGCCGCCGCCGCCGCCGGGG + Intergenic
1152077509 17:78168586-78168608 CGCCGCCGCTGCCGCCGCCGCGG - Exonic
1152222209 17:79075059-79075081 GGCCGCCGCCGCCGCGGCCGCGG - Exonic
1152349594 17:79777639-79777661 GAGCGACTCCCCCGCTGCCGAGG + Intergenic
1152353635 17:79796791-79796813 TGCCGCCGCCGCCGCCGCCACGG + Intronic
1152552318 17:81035706-81035728 GCCCGCCGCCCCCGCCGCCCCGG - Intronic
1152704321 17:81834895-81834917 ATCCGCCGCCGCCGCTGCCGTGG + Exonic
1152728741 17:81959955-81959977 GAGGACCGCCGCCCGCGCCGAGG - Intronic
1152729123 17:81961254-81961276 ATGTGCCGCCGCCGCCGCCCGGG + Exonic
1152789968 17:82273574-82273596 GAGCGCCGCCGCCGCTGCTCCGG + Exonic
1152824807 17:82458308-82458330 GAGCCCGGCCGCGGCCTCCGCGG + Intronic
1153040816 18:812015-812037 CGCCGCCGCCGCCGCCGCCGCGG - Intronic
1153457177 18:5295128-5295150 TCGCGCCGCCGGGGCCGCCGCGG - Intronic
1153514493 18:5891385-5891407 GGCCGCCGCGGCCGCCGCCGCGG - Exonic
1153688383 18:7567900-7567922 GACCGCCTCTGCCGCCCCCGAGG + Intronic
1153805309 18:8705327-8705349 GCGCGCCGCCAGCGCCGCCGCGG + Intergenic
1154070533 18:11148713-11148735 GAGCGTCGCGGCCCGCGCCGAGG - Intronic
1154173773 18:12068425-12068447 CCGCGCCGCCGCCGCCGCCGGGG + Intergenic
1154210763 18:12377074-12377096 GTGCGCCATGGCCGCCGCCGTGG + Exonic
1154268212 18:12897117-12897139 CGCCGCCGCCGCCGCCGCCGCGG + Intronic
1154303998 18:13217801-13217823 GCGCGCCGCCGCGGCCGGCCGGG + Intronic
1155007507 18:21741525-21741547 CGCCGCCGCCGCTGCCGCCGGGG - Exonic
1155053817 18:22169033-22169055 GAGCGCCCCTCCCGCCGCGGCGG + Intergenic
1155152778 18:23135810-23135832 CAGCGCCGGCACCGACGCCGCGG + Exonic
1156088810 18:33440756-33440778 CGCCGCCGCCGCCGCCCCCGCGG - Intronic
1156149143 18:34223022-34223044 TGGCGCCGCCGCCTCCCCCGCGG + Exonic
1157867049 18:51196763-51196785 CACCCCCGCCGCCGCCGCCGCGG + Exonic
1158954158 18:62523597-62523619 TGCCGCCGCCGCCGCCGCCCCGG + Exonic
1159744005 18:72209450-72209472 GAGCGCCGCCCCCTTCTCCGCGG + Intergenic
1160216368 18:76935918-76935940 GAGCGCTGAAGCAGCCGCCGGGG - Intronic
1160577249 18:79863688-79863710 GGGTCCCGCCGCCGCCGCCCGGG - Exonic
1160706306 19:531784-531806 CTGCGCCGCCGCCGCCGCCCGGG - Exonic
1160706345 19:531913-531935 GGGCCCCTCCGCCGCCGCCATGG + Exonic
1160921798 19:1524145-1524167 CTGCGCCGCCGCCGCGGCCGGGG - Intronic
1160930464 19:1567639-1567661 CCCCGCCGCCGCCGCCGCCCCGG - Exonic
1160930702 19:1568310-1568332 CCGCGCCGCCGCCGCCGCCTCGG - Intergenic
1160935427 19:1592449-1592471 GGGCGCCGAGGCCGCCGCAGAGG + Intronic
1160960602 19:1719042-1719064 GATCGGTGCCGCCGCCGCAGCGG + Intergenic
1160967914 19:1754574-1754596 GGCCGCCGCCGCTCCCGCCGGGG - Exonic
1160968921 19:1758785-1758807 GACCGCCCCCACCCCCGCCGAGG - Intronic
1160991603 19:1862583-1862605 GAACCGCGTCGCCGCCGCCGGGG - Intronic
1161031896 19:2061444-2061466 GCGCGCGGCCGCCGCCGGGGAGG - Intergenic
1161165591 19:2785550-2785572 AACCGCCGCCACCGCCGCCACGG - Exonic
1161175989 19:2842162-2842184 GGGCGTCTCCGCCCCCGCCGAGG - Intronic
1161400705 19:4065462-4065484 CGCCGCCACCGCCGCCGCCGGGG - Intronic
1161461887 19:4402658-4402680 CCGCGCCGCTGCTGCCGCCGCGG - Exonic
1161560290 19:4969264-4969286 GAGCGCGGACCCCGCCGCCATGG + Intronic
1161703246 19:5805938-5805960 GCTCGCCGCCGCCGCCGCCGGGG + Intergenic
1161791260 19:6361660-6361682 CAGCGCAGCGGCCGCCGCAGCGG + Exonic
1162033203 19:7926049-7926071 GGCCGCCGCCGCCGCCGCCGGGG - Exonic
1162421672 19:10568984-10569006 CTGCGCCGCCGCCGCCGCTGAGG + Intronic
1162535826 19:11262448-11262470 GCGTCCCGCCGCCGCCGCCCCGG + Exonic
1162751759 19:12833852-12833874 CGCCGCCGCCGCCGCCGCCGCGG + Intronic
1162778697 19:12995766-12995788 GAGCGCGGCCGCCGCCTGCCGGG + Exonic
1162954294 19:14089946-14089968 CGGCGCCGCCGCTGCCCCCGAGG + Exonic
1163320476 19:16571904-16571926 GGGCCCGGCCGCCGCCCCCGAGG + Intronic
1163606979 19:18280983-18281005 CGCCGCCGCCGCCGCCGCCGGGG - Exonic
1163607140 19:18281576-18281598 GGGCGCTGCGGCCGCGGCCGGGG - Exonic
1163631348 19:18419471-18419493 CGCCGCTGCCGCCGCCGCCGCGG + Exonic
1163631398 19:18419623-18419645 GCTCCACGCCGCCGCCGCCGGGG - Exonic
1163807252 19:19406450-19406472 CGCCGCCGCCGCCGCCGCCGCGG - Intronic
1164693728 19:30228336-30228358 CAGGGCCCCCGCCCCCGCCGGGG + Intronic
1165058640 19:33194460-33194482 GAGCCCCGCCGCGGCCGGCCTGG - Intronic
1165089157 19:33373690-33373712 GCGCGCCGCCGCCGCCATCCCGG - Exonic
1165509435 19:36257562-36257584 AAGCGCCGCCACCGCCGCCCCGG + Intergenic
1165510969 19:36266525-36266547 CACCGCCGCCACCGCCGCCCCGG + Intergenic
1165559705 19:36668310-36668332 GAGCGCCGCCACTCCCGCAGTGG + Intergenic
1165628099 19:37289381-37289403 CTGCGCCGCCACCGCCGCCACGG - Intergenic
1165758048 19:38305394-38305416 CTGCGCCGCCGCCACCGCCATGG + Exonic
1165803137 19:38565194-38565216 CGTCGCCCCCGCCGCCGCCGTGG - Exonic
1165961634 19:39539828-39539850 CAACGCCGCCGCTGCCACCGGGG + Exonic
1166245422 19:41522224-41522246 TGTCGCGGCCGCCGCCGCCGAGG - Intergenic
1166304101 19:41928011-41928033 GAGCGCCGCGGCCGGCGCAGGGG - Intronic
1166361253 19:42253868-42253890 CGCCGCCGCCGCCGCCGCCGGGG + Intronic
1166807694 19:45496977-45496999 CGCCGCCGCCGCCGCCGCCCTGG + Exonic
1166984146 19:46649581-46649603 CTGCGCAGGCGCCGCCGCCGGGG - Exonic
1167052805 19:47089966-47089988 GAGGGCAGCAGCCGCGGCCGAGG - Exonic
1167237176 19:48322066-48322088 GTGGGCAGCAGCCGCCGCCGCGG - Intronic
1167309538 19:48729068-48729090 GCGCGCCGCAGCCGCCGGCTCGG - Exonic
1167466285 19:49652418-49652440 GACCGCGACAGCCGCCGCCGGGG + Exonic
1167622690 19:50568130-50568152 CAGCCCCACCGCCGCCGCTGCGG - Intergenic
1167649042 19:50719620-50719642 GAGCGCCCCCCCTTCCGCCGCGG + Intergenic
1168064056 19:53909423-53909445 GGCCGCCGCCGCCGCCACCGGGG - Exonic
1168073072 19:53963340-53963362 AGGCGCCGCCGCCCCCGCGGTGG - Exonic
1168694409 19:58396565-58396587 GGCCGCCGCCGCCCCCGCCCGGG + Exonic
1168721769 19:58558393-58558415 CGCCGCCGCTGCCGCCGCCGCGG + Exonic
1202681423 1_KI270712v1_random:7112-7134 GCCCTCCGCCGCCGCCGCCCCGG - Intergenic
926268113 2:11344461-11344483 AAGTGGCGCCGCCACCGCCGCGG + Exonic
927881457 2:26692709-26692731 CGCCGCCGCCGCCGCCGCCGCGG - Intronic
928540275 2:32278078-32278100 GGTCGCCGCCGCGGCCGCCTCGG + Exonic
929604241 2:43224811-43224833 GGCCGCAGCCGCGGCCGCCGCGG + Exonic
930011420 2:46941034-46941056 CCCCGCCGCCGCCCCCGCCGCGG - Intronic
931254111 2:60555286-60555308 AGCCGCCGCCGCCGCCGCCGGGG + Intergenic
931392184 2:61853907-61853929 GATCGCCTCCGCTGCCGCCAGGG + Exonic
931695172 2:64865710-64865732 CTGCGCCGCCGCCGAGGCCGCGG - Intergenic
932621866 2:73269444-73269466 GGCCGCCGCCGCCGCTGCCTCGG - Exonic
932621871 2:73269465-73269487 CGACGGCGCCGCCGCCGCCGCGG - Exonic
932699849 2:73985058-73985080 GGCCGCCGCCGCCGCCGCCTGGG - Intergenic
932699999 2:73985463-73985485 GAGGGCGGCCCGCGCCGCCGAGG - Intergenic
933666860 2:84971283-84971305 CGCCGCCGCCGCCGCCGCCGCGG + Exonic
933858435 2:86441449-86441471 GAGCGCCGCGGCCTCGGCTGCGG + Intronic
933886183 2:86720649-86720671 GAGCGCCGCCGCCTCCGGCATGG + Exonic
933923998 2:87076057-87076079 GAGCGCCGCCGCCTCCGGCATGG - Intergenic
934031860 2:88055592-88055614 CCGGGCCGCCCCCGCCGCCGGGG + Intronic
934248016 2:90324088-90324110 CCCCGCCGCCGCCGCCGCCGCGG - Intergenic
934248169 2:90324632-90324654 CGCCGCCGCCGCCGCCGCCGCGG - Intergenic
934248184 2:90324693-90324715 CGCCGCCGCCGCCGCCGCCGCGG - Intergenic
934248358 2:90325306-90325328 CGCCGCCGCCGCCGCCGCCGCGG - Intergenic
934248369 2:90325344-90325366 CGCCGCCGCCGCCGCCGCCGCGG - Intergenic
934248380 2:90325382-90325404 CGCCGCCGCCGCCGCCGCCGCGG - Intergenic
934248396 2:90325446-90325468 CGCCGCCGCCGCCGCCGCCGCGG - Intergenic
934261193 2:91478105-91478127 CGCCGCCGCCGCCGCCGCCCCGG + Intergenic
934296814 2:91749016-91749038 CACCCTCGCCGCCGCCGCCGCGG + Intergenic
934304465 2:91809922-91809944 CGCCGCCGCCGCCGCCGCCGCGG + Intergenic
934328792 2:92042828-92042850 CGCCGCCGCCGCCGCCGCCGCGG - Intergenic
935112318 2:100104804-100104826 CGCCGCCGCCGCCGCCGCCGCGG + Intronic
935196646 2:100820245-100820267 CGCCGCCGCCGCCGCCGCCGCGG - Exonic
935592441 2:104855292-104855314 CGCCGCCGCCGCCGCCGCCGCGG - Intergenic
935592617 2:104855837-104855859 CGCTGCCGCCGCCGCCGCCGTGG + Exonic
935592782 2:104856389-104856411 CGCCGCCGCCGCCGCCGCCGTGG - Exonic
935692615 2:105744881-105744903 CGCCGCCGCCGCCGCTGCCGCGG + Exonic
935866482 2:107392608-107392630 GAGCGCCGCCCCCTGCTCCGCGG + Intergenic
935896802 2:107747376-107747398 GAGCGCCGCCCCCTGCTCCGGGG - Intergenic
935991041 2:108719391-108719413 GAGCGCCGACGTCGCCAACGTGG + Intergenic
936433184 2:112482010-112482032 CTGCGCCGCCGCCGCCCCCGGGG + Intergenic
938555000 2:132416397-132416419 GAGCGCCGCAGCTGCCTCTGCGG + Intergenic
939629760 2:144517172-144517194 CGCCGCCGCCGCCGCCGCCTCGG + Intronic
939969667 2:148644971-148644993 CCGCCCCGCCGCCGCCGCCCGGG + Exonic
940265134 2:151828359-151828381 AGGCCCCGCCGCTGCCGCCGCGG + Exonic
940830064 2:158457031-158457053 GTTGGCCACCGCCGCCGCCGGGG + Intronic
941119110 2:161507855-161507877 CCCCGCCGCCGCCGCCGCCGCGG + Intronic
941818747 2:169824803-169824825 GTGCGCCGCCGCCGTCTCCTGGG - Exonic
941951496 2:171160835-171160857 GCCCGCCGCCGCCGCCTCCCGGG - Intronic
942241115 2:173964682-173964704 CGCCGCCGCCGCCGCCGCCGGGG - Intronic
942446774 2:176083374-176083396 GAGCGGCGCCGAGGCCCCCGGGG + Exonic
942450899 2:176107580-176107602 TGCCGCCGCCGCCGCCGCCGCGG - Exonic
942450919 2:176107631-176107653 CGCCGCCGCCGCCCCCGCCGGGG - Exonic
942560357 2:177212842-177212864 GGCCGTCGCCGTCGCCGCCGGGG + Exonic
942681346 2:178480615-178480637 TGTCGCGGCCGCCGCCGCCGAGG + Exonic
943185165 2:184598312-184598334 GCGCGGCGCCGCTGCCGCAGAGG - Intergenic
943571506 2:189580771-189580793 CGCCGCCGCCGCCGCCGCCGTGG + Exonic
943669872 2:190649112-190649134 AGGAGCCGCCGCCGCCGCCGCGG + Intronic
944457616 2:199911540-199911562 GCGCGCCGCCGCTGCCGCCCGGG - Exonic
944831219 2:203535342-203535364 CGCCGCCGCCGCCGCCGCCGCGG - Exonic
945466017 2:210171322-210171344 CGCCGCCGCCGCCGCCGCCGCGG + Exonic
945988377 2:216372293-216372315 TATCTCCGCCGCCGGCGCCGCGG + Intergenic
946248566 2:218400231-218400253 GGGAGCCGCCGCCGCCGCCCCGG + Intronic
946354860 2:219178291-219178313 GGGCTGCGCGGCCGCCGCCGGGG - Exonic
946921430 2:224585161-224585183 CGCCGCCCCCGCCGCCGCCGCGG - Exonic
946921523 2:224585493-224585515 GAGCCCGGCGGCCGCCGCGGGGG + Intergenic
946966440 2:225042281-225042303 CAGCGCCGCGTCCGCCGCCGCGG - Exonic
947506658 2:230713050-230713072 CCGCGCAGCCGCCGCCGCCGCGG + Exonic
947641162 2:231708602-231708624 GCGCGCCTCCTCCGCCGCCGCGG + Exonic
948216514 2:236237242-236237264 CAGCCCAGCCGCCGGCGCCGGGG - Intronic
948438130 2:237967399-237967421 GTCCCCCGCCGCCGCCGCCGCGG - Intronic
948473720 2:238203410-238203432 GGGCGCCGCCTCAGCCGCCCCGG + Intronic
948487251 2:238288752-238288774 CAGCGCCGCCGCCTCCGCCGCGG + Intronic
948801632 2:240435900-240435922 GGGCGCCGCCGGCCCCGCCATGG + Exonic
1168753124 20:297750-297772 GCGAGCCGCGGCCGCCGCGGCGG + Exonic
1168965409 20:1895282-1895304 AGCGGCCGCCGCCGCCGCCGCGG - Intronic
1169093164 20:2873618-2873640 CGAGGCCGCCGCCGCCGCCGCGG + Intronic
1169171830 20:3471355-3471377 CACCGCCGCCGCCGCCGCCGCGG - Exonic
1169204604 20:3732702-3732724 GAGGGCTGCGGCCGCCGCAGCGG + Exonic
1169214727 20:3786510-3786532 CGGCGCCGCCGCCGCCGCCCCGG + Exonic
1169424387 20:5485000-5485022 GAGCGCCGCCCCCGCAGCTAAGG + Intergenic
1170617804 20:17968481-17968503 GGCCGCCGCCGCCGCCGCCTGGG + Intronic
1171011502 20:21511858-21511880 CCTCGCCGCCACCGCCGCCGGGG + Exonic
1171973377 20:31578609-31578631 GAGCGCCGCCCCCTCCTCCATGG - Intergenic
1171977590 20:31605405-31605427 CAGCACCGCCACCGCCGCCGCGG + Exonic
1172083173 20:32358519-32358541 GGCAGCCGCCGCTGCCGCCGTGG + Exonic
1172083251 20:32358747-32358769 TGGAGCTGCCGCCGCCGCCGGGG + Exonic
1172275021 20:33674553-33674575 GGGCGCCTCCCCCTCCGCCGTGG - Intergenic
1172474460 20:35226680-35226702 CGCCGCCGCCGCCGCCGCCTCGG - Exonic
1172587077 20:36092579-36092601 GATCGCCGCCGCCTCCTCCGGGG + Intronic
1173672872 20:44810292-44810314 CGCCGCCGCCGCCGCGGCCGAGG - Intronic
1173672875 20:44810298-44810320 CGCCGCCGCCGCCGCCGCCGCGG - Intronic
1173803732 20:45911092-45911114 GGGCCCCGCCTCCACCGCCGAGG + Intronic
1173813584 20:45971272-45971294 CAGCGACGCCGCGGCCGCCCCGG - Exonic
1174258796 20:49278262-49278284 GCCCGCCGGCTCCGCCGCCGGGG - Intronic
1174287771 20:49484198-49484220 AGCCGCCGCCGCCGCCGCCGCGG - Intergenic
1174317463 20:49713761-49713783 GGCCGCCGCCGCCACCGCCTGGG + Exonic
1174506948 20:51023115-51023137 GCGCGGCGCAGCAGCCGCCGAGG + Exonic
1175429373 20:58891237-58891259 CCCAGCCGCCGCCGCCGCCGCGG + Intronic
1175429537 20:58891708-58891730 CGCCGCCGCCGCCGCCGCCATGG + Intronic
1175847236 20:62065366-62065388 CGCCGCCGCCGCCGTCGCCGCGG - Exonic
1175856278 20:62122541-62122563 GCCCGCCGCCGCCTCCGCCTGGG - Exonic
1176194532 20:63831156-63831178 GATCGCCGCCGCCGCCGGGAGGG + Intronic
1176207109 20:63895197-63895219 CGCCGCCGCCGCCGCCGCCCGGG + Exonic
1176548360 21:8211521-8211543 GCGCGGCGGCGGCGCCGCCGCGG - Intergenic
1176548596 21:8212230-8212252 CCGCGCCGCCGCCGCCGCCGCGG + Intergenic
1176548597 21:8212233-8212255 CGCCGCCGCCGCCGCCGCGGCGG + Intergenic
1176550079 21:8217163-8217185 GGGCGTCGCGGCCGCCCCCGGGG + Intergenic
1176556490 21:8256438-8256460 CCGCGCCGCCGCCGCCGCCGCGG + Intergenic
1176556491 21:8256441-8256463 CGCCGCCGCCGCCGCCGCGGCGG + Intergenic
1176567291 21:8394556-8394578 GCGCGGCGGCGGCGCCGCCGCGG - Intergenic
1176567527 21:8395265-8395287 CCGCGCCGCCGCCGCCGCCGCGG + Intergenic
1176567528 21:8395268-8395290 CGCCGCCGCCGCCGCCGCGGCGG + Intergenic
1176569006 21:8400198-8400220 GGGCGTCGCGGCCGCCCCCGGGG + Intergenic
1176575429 21:8439480-8439502 CCGCGCCGCCGCCGCCGCCGCGG + Intergenic
1176575430 21:8439483-8439505 CGCCGCCGCCGCCGCCGCGGCGG + Intergenic
1176576920 21:8444433-8444455 GGGCGTCGCGGCCGCCCCCGGGG + Intergenic
1176619151 21:9043130-9043152 CAGCGCCGGCGCAGGCGCCGGGG - Intergenic
1177011053 21:15730366-15730388 CGCCGCCGCCGCCGCCGCCGCGG + Exonic
1177011057 21:15730369-15730391 CGCCGCCGCCGCCGCCGCGGGGG + Exonic
1178493852 21:33070948-33070970 GGCCGCCTGCGCCGCCGCCGGGG - Exonic
1178513833 21:33229902-33229924 CCGCGCCGCCGCCGGCGCGGGGG - Intronic
1178513837 21:33229905-33229927 GCGCCGCGCCGCCGCCGGCGCGG - Intronic
1178962033 21:37073775-37073797 GAGCGCCCACGCAGCCGCCAGGG - Intronic
1178992480 21:37367197-37367219 AGGAGCCGCCGCCGCCGCCCGGG + Intronic
1179561595 21:42219239-42219261 CGCCGCCGCCGCCGCCCCCGGGG + Exonic
1179674987 21:42974965-42974987 AGGCGCCGCCGCCGCCGCGCTGG + Intronic
1180014710 21:45074595-45074617 CGCCGCCGCCGCCGCCGCCACGG - Intronic
1180064420 21:45405389-45405411 AGGCGCCGCCGCCGCGGCCATGG - Intronic
1180189470 21:46155578-46155600 GTGCTCCGCAGCCGCCGCCAGGG + Intronic
1180193410 21:46180115-46180137 GACCGTGGACGCCGCCGCCGTGG - Intronic
1180614774 22:17120233-17120255 CCGCGCCGCCGGCGCCCCCGCGG + Exonic
1180649956 22:17369505-17369527 GGCGGCCGCCGCCGCAGCCGCGG + Exonic
1180650003 22:17369665-17369687 GCGCCCCGCCGCCCCCGCCGAGG + Exonic
1180891407 22:19291655-19291677 CGCTGCCGCCGCCGCCGCCGAGG - Exonic
1180960709 22:19761110-19761132 CAGCGCCGCCGCCGAGCCCGAGG + Exonic
1181026853 22:20131825-20131847 CGCCGCCGCCGCCGCCGCCGCGG + Intronic
1181087707 22:20449957-20449979 AAGCGTCGCCGCCGCCGCCCCGG - Intronic
1181934620 22:26429610-26429632 CGCCGCCGCCGCCCCCGCCGAGG + Intronic
1182236912 22:28883501-28883523 GGCCTCCGCAGCCGCCGCCGTGG - Intergenic
1183466705 22:37983794-37983816 GGCCGCCGCCGCCGCCGCCTCGG + Exonic
1183486184 22:38088887-38088909 TGGCGCCCCCGCCGCCGCCCGGG + Exonic
1183525002 22:38317495-38317517 GCCCGCCGCCGCCGCCCCGGAGG + Intronic
1183665529 22:39244010-39244032 GCGCGCCGCCCCCGCGGCCAGGG + Exonic
1183667381 22:39253663-39253685 GAGCGCCCGGGCCGCCGCCCCGG + Intergenic
1183912948 22:41092442-41092464 CCGCGCCGCCGCCGCCGCACCGG - Exonic
1184086632 22:42269910-42269932 GAGCGCGGCCGGTGCCCCCGGGG + Intronic
1184101810 22:42344726-42344748 GAGCGCAGCCGCAGAGGCCGCGG - Intergenic
1184153155 22:42649826-42649848 GAGCGGAGGCGCCGCCGGCGAGG - Intergenic
1184545439 22:45164272-45164294 GAGTGCAGCGGCGGCCGCCGAGG + Exonic
1184767035 22:46577398-46577420 CGCCGCCGCCGCCGCCGCCCGGG + Intronic
1185055267 22:48575868-48575890 CGCCGCCGCCACCGCCGCCGCGG - Intronic
1185229071 22:49670239-49670261 GAGCGCCGCCCCCTGCTCCGCGG - Intergenic
1185313824 22:50170433-50170455 GCGCTCCGCCGCCGCCCCCGGGG - Intergenic
1185336175 22:50271779-50271801 AACCGCGGCCGCGGCCGCCGGGG + Intergenic
1185374291 22:50474964-50474986 CGCCGCCGCCGCCGCCGCCGCGG - Exonic
1203238467 22_KI270732v1_random:30913-30935 CGCCGCCGCCGCCGCCGCCGGGG + Intergenic
1203253480 22_KI270733v1_random:128535-128557 CCGCGCCGCCGCCGACGCCGCGG + Intergenic
1203254969 22_KI270733v1_random:133489-133511 GGGCGTCGCGGCCGCCCCCGGGG + Intergenic
1203261534 22_KI270733v1_random:173613-173635 CCGCGCCGCCGCCGCCGCCGCGG + Intergenic
1203261535 22_KI270733v1_random:173616-173638 CGCCGCCGCCGCCGCCGCGGCGG + Intergenic
1203263025 22_KI270733v1_random:178568-178590 GGGCGTCGCGGCCGCCCCCGGGG + Intergenic
949414382 3:3799849-3799871 TGCTGCCGCCGCCGCCGCCGTGG + Exonic
949461966 3:4303498-4303520 GGGCGCCGGCGCGGCCCCCGGGG - Exonic
949533350 3:4978357-4978379 CAGGGCAGGCGCCGCCGCCGCGG + Intergenic
949970242 3:9397672-9397694 CGCCGCCGCCGCCGCTGCCGGGG + Intronic
950000032 3:9649598-9649620 GGCCGCCGCCGCCGCTGCCTCGG + Exonic
950374289 3:12557326-12557348 GAGCGCTGCCGCCACAGCCGGGG + Intronic
951217700 3:20040420-20040442 AGGCGCCGCCGCCGCCGCCAGGG - Exonic
951717527 3:25664849-25664871 AGCCGCCGCCGCCGCCGCCACGG + Intronic
951907896 3:27721913-27721935 CGCCGCCGCCGCCGCCGCCGCGG - Exonic
953705054 3:45225154-45225176 CGCCGCTGCCGCCGCCGCCGCGG - Exonic
953705144 3:45225514-45225536 CGCCGCCGCCGCCACCGCCGGGG - Exonic
953947773 3:47164011-47164033 CGCCGCCGCCGCCGCCGCCGCGG - Intergenic
954176228 3:48847803-48847825 CTGGGCAGCCGCCGCCGCCGCGG + Exonic
954367814 3:50155515-50155537 CCGTGCCGCCGCCGCCGCCCGGG + Exonic
955228418 3:57079270-57079292 CGCCGCAGCCGCCGCCGCCGCGG - Exonic
955911573 3:63863958-63863980 CGCCGCCGCCGCCGCCGCCGCGG + Intergenic
956659154 3:71582371-71582393 CGGCGCCGCCGCCACCGCCGTGG + Intronic
956677974 3:71753533-71753555 GGGCGCCTCCGCAGCAGCCGCGG - Intronic
956678016 3:71753646-71753668 CGCCGCCGCCGCCGCCGCCGCGG - Intronic
957028634 3:75214592-75214614 GGCCGTCGCCGTCGCCGCCGGGG + Intergenic
958718933 3:97821901-97821923 GGGCGCAGCCGCCACCGCTGGGG - Intergenic
958900140 3:99876283-99876305 CTGCGCCGCCGCCGCGGCCGAGG - Intronic
959530731 3:107431535-107431557 GGTCACCGCCGCCGCCGCCGGGG + Intergenic
960120872 3:113947885-113947907 GTGCCCCGCCCCCGGCGCCGGGG - Exonic
960386409 3:117026593-117026615 GCGCGCCTCCTCAGCCGCCGCGG + Intronic
960577157 3:119240849-119240871 GCTCGCCGCGGCCGCCTCCGGGG - Intronic
960664217 3:120094381-120094403 CGCCGCCGCCGCCGCCGCCCGGG - Intronic
961252692 3:125520205-125520227 CTGCGCCGCCGCCGCGCCCGCGG + Intergenic
961408926 3:126704402-126704424 GAGCGGCGCCGCCTGGGCCGGGG + Intronic
961739986 3:129027247-129027269 GAGCACCGCCGCCGCCCGCGGGG - Intronic
961780170 3:129316429-129316451 CAGCGCCGCCGCGCCCGCAGCGG + Intergenic
961827254 3:129605646-129605668 TGGCGTCGCCGCCGGCGCCGTGG + Exonic
962071205 3:132035132-132035154 GAGCGCCGCCGCCAAGGCCTGGG - Exonic
962793991 3:138835006-138835028 CGCCGCCGCCGCCGCCACCGCGG - Intergenic
963117027 3:141738694-141738716 GAGGGCTGCGGCCGCCGCCTGGG + Intronic
963602579 3:147390951-147390973 ACGCGCCGCCACCGCCGCCGAGG + Exonic
963904455 3:150762657-150762679 CGGCCCCGCCGCCGCCGCCGGGG + Exonic
964201223 3:154121388-154121410 GCGGGCCGGCGCCGGCGCCGCGG + Intronic
965520133 3:169662776-169662798 GCCCGCCGCCGCCGCCACTGTGG + Intronic
966182200 3:177197562-177197584 CGCCGCCGCCGCCGCCGCCGCGG - Intergenic
966201081 3:177359913-177359935 GAGCTCCGGCTCTGCCGCCGCGG - Intergenic
966362930 3:179148911-179148933 CAGGGCCGCCGCCCCGGCCGCGG + Intronic
966911423 3:184562258-184562280 CGCCGCCGTCGCCGCCGCCGGGG + Exonic
967272022 3:187740056-187740078 CAGCGCCGTCGCCCCCGCCCGGG - Intronic
967904102 3:194486795-194486817 GCACGCCGCCGCCGCGGGCGCGG - Intronic
968221448 3:196942942-196942964 GAGCTACGCCGCGGCCTCCGAGG + Intergenic
968514994 4:1012068-1012090 GCGCGCCGCCGCCGCTCCTGCGG + Intronic
968659592 4:1793600-1793622 GTTTGCCGCCGCCGCCGCCCTGG + Intronic
968659642 4:1793711-1793733 GCCCGCCGCCGCCGCCGCCCAGG - Intronic
968674713 4:1871346-1871368 CGCCGCCGCCGCCGCAGCCGGGG - Intergenic
968701299 4:2059400-2059422 CGCCGCCGCCGCCGCCGCCGCGG + Intergenic
968955018 4:3713941-3713963 GAGAGCCGCTGCCGCCGCTGTGG + Intergenic
968965362 4:3766614-3766636 CAGCGCCGCCGCCAGCGCCGGGG - Exonic
969582198 4:8071959-8071981 GGGAGCTGCCGCCGCCGCGGTGG - Intronic
970195213 4:13544911-13544933 GGCTACCGCCGCCGCCGCCGGGG - Exonic
970333008 4:15003720-15003742 CGCCGCCGCCGCCGCCGCCCGGG - Exonic
970456240 4:16226632-16226654 TGCCGCCGCCGCCGCCGCCACGG + Intronic
970456350 4:16226993-16227015 GAGCCGGGCCCCCGCCGCCGCGG - Intronic
971244084 4:24912928-24912950 TCGCGTCGCCGCCGCCGCCCGGG + Intronic
971327430 4:25655737-25655759 GCCTGCCGCAGCCGCCGCCGGGG - Intronic
972321553 4:37977360-37977382 CGCCGCCGCCGCCGCCGCCGGGG + Intronic
972396658 4:38664107-38664129 GGGAGCCGCCGCGGCCGCCCGGG - Intergenic
972437249 4:39045338-39045360 GAGCGCCGGAGCCGGCGCCCGGG + Intronic
972725830 4:41745990-41746012 TGCCGCCGCCGCCGCTGCCGCGG + Exonic
972817179 4:42657141-42657163 GAGCTCGGGCGCCGGCGCCGGGG + Intergenic
973137316 4:46724426-46724448 GCGCCCTGCCGCCGCCGCCGCGG - Intergenic
974839762 4:67286784-67286806 GAGTGCCCCCACCCCCGCCGTGG - Intergenic
975166715 4:71186589-71186611 GAGCCGCGCCGCCTCCGCCGGGG - Intergenic
975689528 4:76950033-76950055 CACAGCCGTCGCCGCCGCCGCGG - Intronic
975985957 4:80202065-80202087 CACCGCCGCCGCCGCCCCCGTGG - Exonic
976146130 4:82044194-82044216 CAGCCCCTCCGCCGCAGCCGCGG - Intronic
976390018 4:84497707-84497729 GCCCGCCGCCGCCGCCGCCCGGG - Exonic
976431241 4:84966002-84966024 GGGAGCCGCCGCCGCCGCCAGGG - Intronic
976600712 4:86935286-86935308 GGCCCCCGACGCCGCCGCCGCGG + Intronic
977257546 4:94757912-94757934 CGCCGCCGCCGCCGCCACCGCGG - Intergenic
977810033 4:101347386-101347408 GAGCGCCGCCGCTGGTGCCGCGG + Exonic
978072626 4:104491565-104491587 CAGCAGCGCCGCCGCCGCCGCGG - Exonic
978777204 4:112516020-112516042 GGCCGCCGCCGCCGCCGCCGGGG - Exonic
979547168 4:121951565-121951587 GAGCCGCAGCGCCGCCGCCGGGG - Exonic
979685316 4:123505639-123505661 CGCTGCCGCCGCCGCCGCCGAGG + Intergenic
979832059 4:125315762-125315784 GCGCGCAGACGCCGCCGCCTGGG + Intergenic
979899657 4:126201328-126201350 GAGCGCCGCCGCCTGCTCCAGGG - Intergenic
980130066 4:128809971-128809993 CGCCGCCGCCGTCGCCGCCGCGG - Intronic
980328427 4:131379387-131379409 GAGCGCCACCGGCGCAGCCTCGG - Intergenic
982712205 4:158768942-158768964 CCGCGCCGCCGCCGCCGCCGTGG + Intergenic
982745990 4:159104017-159104039 GCCCCGCGCCGCCGCCGCCGCGG + Intergenic
984462995 4:180059167-180059189 GAGCGGAGCCGCCGCCGCCGCGG - Intergenic
984668095 4:182449185-182449207 CACCGCCACCGCCACCGCCGCGG - Intronic
984928365 4:184826031-184826053 TTGCGCCCCCGCCACCGCCGCGG + Intronic
985580658 5:693741-693763 GAGCGCGGCCGCGGCCTCCTGGG + Intergenic
985595282 5:785073-785095 GAGCGCGGCCGCGGCCTCCTGGG + Intergenic
985611628 5:892654-892676 GCCCGCCGCCGGCGCCGCCATGG - Exonic
985696695 5:1344951-1344973 GCGCGCCACCGCCACCGCCGCGG + Exonic
986152482 5:5140273-5140295 TCCCGCCGCCCCCGCCGCCGCGG + Intergenic
986330517 5:6713641-6713663 GTGGAACGCCGCCGCCGCCGCGG + Intergenic
986330851 5:6714717-6714739 GGGCCCCGCCCCCGCCCCCGCGG - Intronic
986813660 5:11385161-11385183 CGCCGCCGCCGCCGCCGCCGCGG - Exonic
987088007 5:14487597-14487619 GGGCGCCGCCGCAGCTGCTGGGG - Exonic
987379932 5:17275609-17275631 GAGCGCGGCCCCTGCCGCCGGGG + Exonic
988437531 5:31193807-31193829 CTCCGCCGCCGCCGCCGCCGCGG - Exonic
988796341 5:34656452-34656474 GAGCGCCGCCGCCGCCTCGATGG + Intronic
989229996 5:39074482-39074504 ACCCGCCGCCGTCGCCGCCGAGG - Intergenic
989576457 5:42992663-42992685 CAGCGCCGCCGCCGCCGCCCGGG - Intergenic
990557735 5:56952171-56952193 AGCCGCCGCCGCCACCGCCGCGG + Intronic
990955144 5:61332803-61332825 CGCCGCCGCCGCCGCCGCCGCGG + Exonic
990955148 5:61332806-61332828 CGCCGCCGCCGCCGCCGCGGGGG + Exonic
991676558 5:69094291-69094313 CAAGGCCGCCGCCGCCGCCGGGG - Exonic
993168263 5:84384179-84384201 GAGCGCCGCTGGCGGCGCGGAGG - Intronic
993900508 5:93581273-93581295 AGCCGCCGCTGCCGCCGCCGGGG - Intergenic
993901219 5:93585113-93585135 CGGCGCCGCCGCCGCCGCCGCGG - Exonic
994353835 5:98773860-98773882 GCGCCCCGCTGCTGCCGCCGCGG + Intronic
994353892 5:98774097-98774119 CGCCGCCGCTGCCGCCGCCGAGG + Exonic
996055068 5:118973691-118973713 ACGCGCCTCCTCCGCCGCCGCGG + Intronic
997302078 5:132813630-132813652 GGCCGCCGCCGCCGCCGCTGCGG + Exonic
997375553 5:133394674-133394696 GAGCGCCGCCACCTGCTCCGTGG + Intronic
997975375 5:138438957-138438979 GGGGCGCGCCGCCGCCGCCGCGG + Intergenic
997975376 5:138438960-138438982 GCGCGCCGCCGCCGCCGCGGCGG + Intergenic
998166675 5:139848292-139848314 GCGCGCCCCCGCCGCCGCCGCGG - Exonic
998366583 5:141636523-141636545 GAGTTCCGCCGCCTCGGCCGGGG - Intronic
998366832 5:141637465-141637487 GATCGCCTCCGCAGCCGCCCTGG - Exonic
998374519 5:141682068-141682090 GAGGGCCGCCGGCGCCGAGGGGG + Intronic
998435918 5:142108795-142108817 AAGCACCGCCGCCGCCGCCGAGG - Exonic
1000319027 5:160119161-160119183 CGCCGCCACCGCCGCCGCCGGGG - Exonic
1001065072 5:168529582-168529604 CCGCGCCGCCGCCGCCGCCTCGG - Exonic
1001928723 5:175658084-175658106 GAGCGCAGCCGGCGCGGGCGCGG + Exonic
1002055827 5:176597468-176597490 CAGCGCCCCCGCCGGGGCCGCGG - Exonic
1002190135 5:177473595-177473617 GGGAGTCGCCGCCGCCGCCTCGG + Intronic
1002559474 5:180071775-180071797 GCGCGCTCCCGCCGCCGCCCGGG - Exonic
1002591074 5:180291981-180292003 CGCCGCCGCCGCCGCCGCAGTGG + Exonic
1002591096 5:180292051-180292073 CTCCGCCGCTGCCGCCGCCGCGG + Exonic
1002666771 5:180831184-180831206 GCCCGCCGCCGCCGCCGCCTCGG + Intergenic
1002691398 5:181053070-181053092 GGGCGCCACCGCAGCCGCCTGGG - Intronic
1002897960 6:1390052-1390074 CGCCGCCGCCGCCGCCGCCCCGG + Exonic
1003049234 6:2765354-2765376 GCGAGGCGCCTCCGCCGCCGGGG + Intergenic
1003049413 6:2766045-2766067 GAGGCCGGCGGCCGCCGCCGCGG + Exonic
1003139303 6:3457224-3457246 ACGCGCGGCCGCCGCCGCCCGGG + Intergenic
1003206947 6:4021387-4021409 AGCCGCCGCCACCGCCGCCGAGG + Exonic
1003224068 6:4189097-4189119 GAGCGTCGCCGTCGCTGCTGTGG + Intergenic
1003325310 6:5086030-5086052 GGGCGCGGCCACTGCCGCCGCGG - Exonic
1003551833 6:7107683-7107705 CGCCGCCGCCGCCGCCGCCGCGG + Intronic
1003623868 6:7726152-7726174 GAATTCCGGCGCCGCCGCCGCGG + Intergenic
1003624093 6:7727054-7727076 TGCCGCGGCCGCCGCCGCCGGGG + Exonic
1004196537 6:13511072-13511094 GAGCGCCGCCCCCTGCTCCGTGG - Intergenic
1004208616 6:13615390-13615412 CATCGCCTCCGCCGACGCCGGGG - Exonic
1004694296 6:18019763-18019785 GAGCCTCCCCCCCGCCGCCGTGG - Intergenic
1004864281 6:19837873-19837895 TGCCGCCGCCGCCGCCGCCGCGG - Exonic
1004924530 6:20403853-20403875 GGGGGCCGCCGACGCCGCGGGGG + Intronic
1005371656 6:25139965-25139987 GAGTGCAGCGGCGGCCGCCGAGG + Intergenic
1006302352 6:33200321-33200343 CGCCGCCGCCGCCGCCGCTGCGG + Exonic
1006337544 6:33428237-33428259 CGCCGCCGCCGCCGCCACCGCGG - Intronic
1006472662 6:34237336-34237358 CCCCTCCGCCGCCGCCGCCGCGG - Intronic
1006547514 6:34792123-34792145 CACAGCCGCCGCCGCCGCCATGG - Exonic
1006725402 6:36196504-36196526 AGGCGCCGCCGCCGCCGCCACGG - Intergenic
1006725495 6:36196786-36196808 GGCCGCCGCCGCCGCTCCCGGGG - Exonic
1007406088 6:41637205-41637227 GAGCGCTGCCGGCGCCGTGGGGG + Intronic
1007558108 6:42783149-42783171 GCGCGCCGCCGCCGCGGGCTCGG - Intronic
1007902045 6:45422031-45422053 CCGCGCCGCCGCCTCCGCGGCGG - Intronic
1012399998 6:98835071-98835093 CGCCCCCGCCGCCGCCGCCGTGG - Exonic
1013117468 6:107114441-107114463 GCTCCCGGCCGCCGCCGCCGCGG + Intronic
1013273255 6:108561081-108561103 GGGCGCCGCCGCCGCCGCCTGGG - Exonic
1013507599 6:110815351-110815373 GGGAGCCGCCGCCGCCGTCGCGG - Intronic
1013514696 6:110875251-110875273 GGGGGCTGTCGCCGCCGCCGAGG + Intronic
1013575803 6:111482958-111482980 GGGCGCCGCCGCCGCTGCGGAGG - Exonic
1013793527 6:113859850-113859872 GGCCGCCGCCGCTGCCCCCGAGG + Exonic
1014802303 6:125790829-125790851 GTGCGCAGCCGCCGCAGTCGGGG - Exonic
1015148925 6:130018507-130018529 CGCCGCCGCCGCCGCTGCCGGGG - Exonic
1015149091 6:130019281-130019303 GAGCGCGGCCGCCGAGGCGGGGG + Intronic
1016010789 6:139135618-139135640 GAACGCTGCGGCCGCCGCGGGGG + Exonic
1017324582 6:153130967-153130989 CCGCGCAGCCGCCCCCGCCGGGG + Intronic
1017662431 6:156687459-156687481 TGGCGCCGCCGAGGCCGCCGCGG - Intergenic
1017672073 6:156778051-156778073 GGATGCCGCCGCTGCCGCCGCGG - Exonic
1017672242 6:156778733-156778755 CGCCTCCGCCGCCGCCGCCGGGG + Exonic
1017672498 6:156779568-156779590 CCGCGCCCCCGCCGCCCCCGCGG - Intronic
1017842334 6:158232163-158232185 CACCGCCGCCGCCGCCGGCCCGG - Intergenic
1019111974 6:169724109-169724131 CAGCGCCGCCGCCACCGCCATGG + Intronic
1019343753 7:519994-520016 GGGCCCGGGCGCCGCCGCCGCGG + Intronic
1019472877 7:1230425-1230447 CCGCGGCGCCGCCGCAGCCGAGG + Intergenic
1019473456 7:1233143-1233165 GTCGGCCGCCGCCGCCGCCTCGG + Exonic
1019473472 7:1233200-1233222 GTGCGCCGCCGCCGCCTCGGTGG + Exonic
1019474246 7:1236431-1236453 CGCCGCCGCCGCCGCCGCCGCGG + Exonic
1020238469 7:6374470-6374492 GAGCGGCGGCGCCGGCGCGGGGG + Intergenic
1020238524 7:6374696-6374718 GCGCCCTGCCGCCGCCGCCGCGG + Exonic
1020383088 7:7567111-7567133 GAGCGCCGCGGCCGCAGCGAGGG + Intronic
1022093606 7:27124192-27124214 AATGGCTGCCGCCGCCGCCGTGG + Intronic
1022100248 7:27165146-27165168 GTCCGGCGCCGCCGCCGCCACGG + Exonic
1022103805 7:27184596-27184618 TGCAGCCGCCGCCGCCGCCGCGG + Exonic
1022103806 7:27184599-27184621 AGCCGCCGCCGCCGCCGCGGAGG + Exonic
1022427947 7:30285534-30285556 CAGCGCCTCCGGCGGCGCCGCGG + Exonic
1022427953 7:30285551-30285573 CGGGGCCGCCGCGGCCGCCGCGG - Exonic
1023418147 7:39950845-39950867 CGCCGCAGCCGCCGCCGCCGCGG + Exonic
1023637587 7:42228070-42228092 CCGCGCCGCCGCCGCGGCCTGGG - Intronic
1023881883 7:44325418-44325440 GAGCCCGTCCGCCGCCGCCATGG - Exonic
1025069679 7:55887596-55887618 CGCCGCCGCCGCCGCCGCGGTGG - Intronic
1025069681 7:55887599-55887621 CGCCGCCGCCGCCGCCGCCGCGG - Intronic
1025615709 7:63114426-63114448 CGCCGCCGCCGCCGCCGCCGCGG - Intergenic
1027211214 7:76150345-76150367 GAGCCAGGCCCCCGCCGCCGTGG + Intergenic
1028086668 7:86644814-86644836 CACCGCCGCCGCTGCCACCGCGG + Exonic
1028477059 7:91264706-91264728 TACCGCAGCCGCCGCCGCCGCGG - Exonic
1029456216 7:100673840-100673862 CGCCGCCGCCGCCTCCGCCGCGG + Exonic
1029640258 7:101815903-101815925 GGCCGCCGCCGCCGCCACCGAGG - Intronic
1029701367 7:102248748-102248770 GACCGCCACCGCCGCGCCCGCGG + Exonic
1029996754 7:105014154-105014176 CGCCGCCGCCGCCGCCGCCGCGG + Intergenic
1030739064 7:113086568-113086590 CACCGCAGCCGCCGCCGCCGCGG - Intronic
1031043449 7:116862571-116862593 CGCTGCCGCCGCCGCCGCCGCGG + Exonic
1031051885 7:116953446-116953468 TCGCGCCGCCGCCGCCGCCGCGG - Exonic
1031317372 7:120273816-120273838 GCTGGCAGCCGCCGCCGCCGTGG - Exonic
1031406911 7:121396527-121396549 GGGAGCTGCCGCCGCCGCAGCGG + Intergenic
1031483462 7:122304111-122304133 CACCGCCGCGGGCGCCGCCGGGG + Exonic
1031532028 7:122886796-122886818 GCGCGCCGCCGCTGCTGCCCGGG + Intergenic
1031986487 7:128167442-128167464 GAGCGCGGCCGGCGCTGCCCTGG + Intergenic
1032117003 7:129126308-129126330 GCGAGCCGCCGCCGCTGCCGAGG - Intergenic
1032174359 7:129611698-129611720 TGCCGCCGCCGCCGCCGCCGAGG - Exonic
1032306114 7:130733793-130733815 GCGCGGCGCCGCCCGCGCCGGGG + Exonic
1032525587 7:132576745-132576767 GAGAGCCGCCGCCGCTGCTCGGG - Exonic
1033288736 7:140063244-140063266 CAGCGCTGCCGCCGCCCTCGAGG - Exonic
1033300013 7:140177026-140177048 CTGAGGCGCCGCCGCCGCCGCGG - Exonic
1033390643 7:140924601-140924623 CGGCGCCGGCGCCGGCGCCGCGG - Exonic
1033477131 7:141702033-141702055 GGGCGCCCCCGCCGCCGCCCCGG + Exonic
1034147033 7:148883514-148883536 GAGCGCCGCGGCCCCAGCCCGGG + Intronic
1034147257 7:148884212-148884234 CGCCGCCGCCGCCGCCGCCGGGG + Exonic
1034469722 7:151248756-151248778 CGCCGCCGCCGCCGCCGCCGCGG + Exonic
1034494186 7:151410222-151410244 CACCTCCGCCGCCGCCGCCTGGG + Intronic
1034618183 7:152436281-152436303 CTTCGCCGCCGCCGCCGCCCGGG - Intergenic
1034977739 7:155457987-155458009 GGGCTCCGGCGCCGCCGCCTGGG - Intergenic
1035169498 7:157009829-157009851 CGCAGCCGCCGCCGCCGCCGCGG + Exonic
1035169538 7:157009945-157009967 CGCCGCCGCCGCCGCCGCTGGGG - Exonic
1035266104 7:157691014-157691036 GAGCCGCGCCGCCGCCGGCCGGG - Intronic
1035404213 7:158587672-158587694 GAGCGCCGCCGGCCAGGCCGCGG - Exonic
1035553015 8:544655-544677 GGCCGCCGCCGCCGCCGCCCAGG - Exonic
1036723726 8:11201066-11201088 CAGCGCCGCCGCCGACGGGGGGG - Exonic
1036789498 8:11708666-11708688 GGCCGCCGCCGCCGCTGCCGCGG + Exonic
1036910843 8:12755614-12755636 GAGCGCGGCCGCGGGCGGCGTGG - Intronic
1037535228 8:19817437-19817459 CGCCGCCGCCGCCGCCACCGCGG - Exonic
1037819910 8:22130582-22130604 GAGCGCCCCCGCCGCCCCGGGGG - Exonic
1039454296 8:37697294-37697316 GGGCGCCGCCTCCGCAGCCGCGG + Exonic
1040065592 8:43141294-43141316 CGCCGCCGCCGCCGCCGCCTGGG + Intronic
1041059501 8:54022275-54022297 CGCCGCCGCCGCCGCCGCCGCGG - Exonic
1041689916 8:60678763-60678785 CGCCGCCGCCGCCGCCGCCGCGG - Exonic
1042040220 8:64581387-64581409 CCCCGCCGCCGCCGCCGCCCAGG - Exonic
1042271914 8:66963120-66963142 GACCGCCTCCGCTGCCCCCGCGG + Intergenic
1043463990 8:80487056-80487078 GCCGGCCGCCGGCGCCGCCGAGG + Exonic
1043464035 8:80487185-80487207 GACCCCCGCCGCCGCCGCCTCGG - Exonic
1043502957 8:80874323-80874345 CGCCGCCGCCGCCGCCGCCCGGG + Intronic
1044335976 8:90985232-90985254 GCCCCCCGCCGCCGCCACCGCGG - Exonic
1044719846 8:95134291-95134313 GTAGGACGCCGCCGCCGCCGCGG + Intronic
1044719849 8:95134294-95134316 GGACGCCGCCGCCGCCGCGGGGG + Intronic
1044819253 8:96144924-96144946 GTGCGCCGCCGCCGGCGGCCGGG + Exonic
1045222577 8:100213258-100213280 GCCCGCCGCCGCCGCCGCAGAGG - Exonic
1045510040 8:102806792-102806814 GGGCGCCCGGGCCGCCGCCGAGG - Intergenic
1045516297 8:102863628-102863650 CGCCGCCGCCGCCGCCGCCGGGG + Intronic
1045737921 8:105318457-105318479 CGGCGCCGCCGCCGCCGCTCCGG - Intronic
1046661153 8:116949786-116949808 GAGCGCCGCCCCCTGCTCCGCGG - Intergenic
1047203011 8:122782041-122782063 CACCGCCGCCGTCGCCGCCGCGG + Intronic
1048214267 8:132480871-132480893 CGCCGCCGCCGCCGCCGCCCCGG - Exonic
1049109852 8:140635788-140635810 CGCCGCCGCCGCCGCCGCCGCGG - Intergenic
1049678157 8:143902696-143902718 GCCCGCAGCAGCCGCCGCCGTGG + Intergenic
1049762199 8:144336653-144336675 GCCCGGCGCCGCCGCCCCCGGGG - Intergenic
1049788438 8:144462373-144462395 CGCCGCCGCCGCCGCCGCCTCGG + Intronic
1051079694 9:13279665-13279687 GGGCCCCGCCACCGCCTCCGCGG - Intergenic
1051418750 9:16870559-16870581 GAGCGCCACCGGGGCCGCCCGGG - Intronic
1052192792 9:25678180-25678202 CGCCGCCGCCGCCGCCGCTGGGG + Exonic
1052991819 9:34523026-34523048 GAGCGCCGCGGCCGCGGAGGAGG - Exonic
1053011793 9:34637791-34637813 GCGCTCCCCCGCCACCGCCGTGG + Intronic
1053114611 9:35490123-35490145 CGCCGCCGCCGCCGCCGGCGCGG + Intronic
1053198293 9:36136528-36136550 GAGCCCCGCGGCCGCATCCGGGG + Intronic
1053434822 9:38067955-38067977 GTGCGCCGCCTCAGCCGCGGAGG - Exonic
1053697501 9:40651086-40651108 CGCCGCCGCCGCCGCCGCCGCGG - Intergenic
1054308790 9:63450486-63450508 CGCCGCCGCCGCCGCCGCCGCGG - Intergenic
1054333334 9:63781656-63781678 GAGCGCCGGCGCAGGCGCGGAGG + Intergenic
1054407652 9:64774845-64774867 CGCCGCCGCCGCAGCCGCCGCGG - Intergenic
1054781992 9:69174194-69174216 GGCTGACGCCGCCGCCGCCGCGG + Intronic
1054798673 9:69325543-69325565 AGTCGCCGCCGCTGCCGCCGCGG + Intronic
1054835655 9:69672554-69672576 CGGTGCCGCCGCCGCCGCCGCGG - Intergenic
1054842626 9:69759823-69759845 GCGCGCCTCCGCCGCCTCCGAGG - Intronic
1055090996 9:72364835-72364857 AGGTGGCGCCGCCGCCGCCGCGG + Intronic
1055091114 9:72365281-72365303 CGCCGCCGCCGCCGCCGCCGGGG - Intergenic
1055514207 9:77020319-77020341 CGCCGCCGCCGCCGCCGCCACGG - Exonic
1055514227 9:77020407-77020429 GGCCGCCGCCGCTGCCGCCGCGG + Exonic
1056475396 9:86947234-86947256 CGCCGCCGCCACCGCCGCCGCGG + Intergenic
1057245613 9:93451897-93451919 CCGCGCCCCCGCCGCCGCCATGG + Exonic
1057313379 9:93954990-93955012 GCCCGCAGCCGCCGCTGCCGCGG - Exonic
1057361146 9:94374747-94374769 GGGCACCGCCGCCGCCTCCGCGG + Exonic
1057489127 9:95508304-95508326 AGCCGCTGCCGCCGCCGCCGCGG + Exonic
1057489144 9:95508367-95508389 CGCCGCCGCCGCCGCCGCCGCGG + Exonic
1057489270 9:95508871-95508893 GCGCAGAGCCGCCGCCGCCGCGG + Intronic
1057662215 9:97013417-97013439 GGGCACCGCCGCCGCCTCCGCGG - Exonic
1057773160 9:97984461-97984483 GGGCGCCGCCGCCGCGGCACAGG - Intronic
1057869777 9:98708894-98708916 CGCTGCCGCCGCCGCCGCCGCGG - Exonic
1058379526 9:104362939-104362961 GAGCGCCGCCCCCTGCTCCGCGG - Intergenic
1058467564 9:105244659-105244681 AGCCGCCGTCGCCGCCGCCGGGG + Exonic
1059405836 9:114098086-114098108 GAGCGCCGGCGGCGCCCCCGCGG - Intronic
1060209083 9:121699426-121699448 GAGCGCCGCCGCCGCCGCCGCGG + Exonic
1060389799 9:123268217-123268239 GGCCGCCGCCGCCGCCGCTGCGG - Intronic
1060479903 9:124011936-124011958 GACCGCAGCCGTCGCCGCCTCGG + Exonic
1060555279 9:124504741-124504763 CCGCGCCGCCGCCGCCGGCGAGG + Intronic
1060770224 9:126326982-126327004 CACCGCCGCCGCCGCCCCAGCGG + Exonic
1062305905 9:135907126-135907148 GAGCGGCCGCGCCGCCGCCGAGG - Exonic
1062315985 9:135967166-135967188 GAGGGCTGACGCCACCGCCGCGG - Intergenic
1062363758 9:136199278-136199300 AGGCGCCGCCCCCGCCCCCGCGG - Intronic
1202779846 9_KI270717v1_random:24374-24396 CGCCGCCGCCGCCGCCGCCGCGG - Intergenic
1203469880 Un_GL000220v1:111682-111704 CCGCGCCGCCGCCGCCGCCGCGG + Intergenic
1203469881 Un_GL000220v1:111685-111707 CGCCGCCGCCGCCGCCGCGGCGG + Intergenic
1203471371 Un_GL000220v1:116635-116657 GGGCGTCGCGGCCGCCCCCGGGG + Intergenic
1203477701 Un_GL000220v1:155654-155676 CCGCGCCGCCGCCGCCGCCGCGG + Intergenic
1203477702 Un_GL000220v1:155657-155679 CGCCGCCGCCGCCGCCGCGGCGG + Intergenic
1203479192 Un_GL000220v1:160607-160629 GGGCGTCGCGGCCGCCCCCGGGG + Intergenic
1185457757 X:319237-319259 CGCCGCCGCCGCCGCCGCCGAGG - Intergenic
1185508283 X:644522-644544 GTCCGCCTCGGCCGCCGCCGTGG + Exonic
1187226076 X:17376086-17376108 GGCCGCCGCCGCCGCCGCCGAGG - Exonic
1187547313 X:20266716-20266738 CGCCGCCGCCGCCGCTGCCGTGG - Exonic
1187826177 X:23334757-23334779 CGCCGCCGTCGCCGCCGCCGCGG + Exonic
1187915600 X:24149968-24149990 GCGCGCCTCCGCCGCCGCTCGGG - Intronic
1190474402 X:50813133-50813155 CGCCGCCGCCGCCGCCGCCAGGG - Intronic
1190712860 X:53082240-53082262 GAGCGCGATCGCCGCCGCGGCGG + Intergenic
1190730962 X:53225179-53225201 CAGCGCCGCCGCCGCCATCTTGG + Exonic
1192034320 X:67546339-67546361 CTGCGCCGCCGCAGCCGCCCAGG - Exonic
1192925002 X:75747086-75747108 CGCCACCGCCGCCGCCGCCGCGG + Intergenic
1194977573 X:100409636-100409658 GAGAGGCGGGGCCGCCGCCGTGG + Exonic
1194977593 X:100409720-100409742 CGCCGCCGCCGCCGCCGCCGCGG + Exonic
1198051632 X:132957454-132957476 CGCCGCAGCCGCCGCCGCCGTGG - Intronic
1198276376 X:135098613-135098635 CAGAGCCGCCGACGCCGCCATGG + Intergenic
1198310134 X:135422130-135422152 CAGAGCCGCCGACGCCGCCATGG - Intergenic
1198767093 X:140091339-140091361 CGCCGCCGCCGCCGCCGCCTCGG - Intergenic
1198807225 X:140504334-140504356 GGCCGCCGCCGCCGCTGCCGCGG - Exonic
1200092490 X:153642452-153642474 GGCAGCCGCCGCCGCCGCTGCGG - Intergenic
1200129006 X:153830923-153830945 GCGCCCCTCCCCCGCCGCCGTGG - Intergenic
1200292504 X:154886395-154886417 GGCCGGCGCCGCCGCCGCCCAGG - Exonic
1200339348 X:155382135-155382157 GGCCGGCGCCGCCGCCGCCCAGG - Exonic
1200347122 X:155458558-155458580 GGCCGGCGCCGCCGCCGCCCAGG + Exonic