ID: 1060209099

View in Genome Browser
Species Human (GRCh38)
Location 9:121699481-121699503
Sequence GTCCCCCGCGCCGCCGCCCC GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 546
Summary {0: 1, 1: 0, 2: 6, 3: 70, 4: 469}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1060209091_1060209099 -6 Left 1060209091 9:121699464-121699486 CCCGCCGCCGCCGCCCGGTCCCC 0: 1
1: 1
2: 20
3: 127
4: 946
Right 1060209099 9:121699481-121699503 GTCCCCCGCGCCGCCGCCCCGGG 0: 1
1: 0
2: 6
3: 70
4: 469
1060209093_1060209099 -10 Left 1060209093 9:121699468-121699490 CCGCCGCCGCCCGGTCCCCCGCG 0: 1
1: 1
2: 13
3: 92
4: 788
Right 1060209099 9:121699481-121699503 GTCCCCCGCGCCGCCGCCCCGGG 0: 1
1: 0
2: 6
3: 70
4: 469
1060209092_1060209099 -7 Left 1060209092 9:121699465-121699487 CCGCCGCCGCCGCCCGGTCCCCC 0: 1
1: 8
2: 38
3: 303
4: 1903
Right 1060209099 9:121699481-121699503 GTCCCCCGCGCCGCCGCCCCGGG 0: 1
1: 0
2: 6
3: 70
4: 469
1060209089_1060209099 15 Left 1060209089 9:121699443-121699465 CCGCGGACAATGAGAGGTGAGCC 0: 1
1: 0
2: 0
3: 3
4: 65
Right 1060209099 9:121699481-121699503 GTCCCCCGCGCCGCCGCCCCGGG 0: 1
1: 0
2: 6
3: 70
4: 469
1060209085_1060209099 24 Left 1060209085 9:121699434-121699456 CCGCCGCCGCCGCGGACAATGAG 0: 1
1: 0
2: 0
3: 12
4: 101
Right 1060209099 9:121699481-121699503 GTCCCCCGCGCCGCCGCCCCGGG 0: 1
1: 0
2: 6
3: 70
4: 469
1060209084_1060209099 27 Left 1060209084 9:121699431-121699453 CCGCCGCCGCCGCCGCGGACAAT 0: 1
1: 0
2: 7
3: 89
4: 699
Right 1060209099 9:121699481-121699503 GTCCCCCGCGCCGCCGCCCCGGG 0: 1
1: 0
2: 6
3: 70
4: 469
1060209088_1060209099 18 Left 1060209088 9:121699440-121699462 CCGCCGCGGACAATGAGAGGTGA 0: 1
1: 0
2: 0
3: 2
4: 50
Right 1060209099 9:121699481-121699503 GTCCCCCGCGCCGCCGCCCCGGG 0: 1
1: 0
2: 6
3: 70
4: 469
1060209086_1060209099 21 Left 1060209086 9:121699437-121699459 CCGCCGCCGCGGACAATGAGAGG 0: 1
1: 0
2: 0
3: 7
4: 59
Right 1060209099 9:121699481-121699503 GTCCCCCGCGCCGCCGCCCCGGG 0: 1
1: 0
2: 6
3: 70
4: 469

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1060209099 Original CRISPR GTCCCCCGCGCCGCCGCCCC GGG Intronic
900134126 1:1107034-1107056 GCCCCCCGCACCCCCGCCCGTGG + Intronic
900207989 1:1439743-1439765 GTGCCCCGCGCCCCGACCCCGGG + Exonic
900240666 1:1615879-1615901 GACCCCAGCGCCGCTGGCCCCGG - Intronic
900585601 1:3431016-3431038 GTCCCCCGCACCCGAGCCCCAGG + Exonic
901019760 1:6249704-6249726 GCAGCCCGCGCCGCCGCCCCGGG - Exonic
902375135 1:16026923-16026945 CCGCCCCGCCCCGCCGCCCCCGG - Intronic
902383241 1:16062380-16062402 GCCCCCCCCCCCCCCGCCCCAGG + Intronic
903324741 1:22563450-22563472 GCCGCCGCCGCCGCCGCCCCGGG - Intergenic
903353134 1:22730219-22730241 GCCACCCCCGCCTCCGCCCCTGG - Intronic
903420917 1:23217407-23217429 GCCGCCCGCCCCGCCGCCCCGGG + Intergenic
903750580 1:25618049-25618071 GGCCCCCGCCGCGCCGGCCCCGG + Exonic
904237091 1:29122977-29122999 GGCCCCCGCCCAGGCGCCCCAGG + Intronic
904641953 1:31937943-31937965 GGCCCCCGCGCCGGCGCCGGGGG - Intronic
904696745 1:32335616-32335638 GGCCCCAGCTCCGCGGCCCCTGG + Intronic
905684898 1:39901299-39901321 GCCCCCCACGTCGCCGCCCTGGG - Exonic
906495737 1:46302889-46302911 GCCCCCCGCGCCCCCGAGCCAGG + Intronic
906637014 1:47416489-47416511 GCCGCCGCCGCCGCCGCCCCGGG - Exonic
909433599 1:75616240-75616262 CTCCCCCACGCCCCCACCCCCGG + Intergenic
909475221 1:76074635-76074657 GGCCCGCGCGGCCCCGCCCCCGG - Intergenic
910221428 1:84893024-84893046 TTCACCCGCGCCGCCGAGCCCGG + Intronic
910237006 1:85047434-85047456 GCCTCCCGCGCCGGCGCTCCGGG - Intronic
911538575 1:99130417-99130439 GACCCCCCCGCCACCGACCCAGG - Intergenic
914523044 1:148435072-148435094 GTGGCCCCCGCCGCCGGCCCTGG + Intergenic
915253538 1:154608124-154608146 GTTTCCCGTGCCGACGCCCCGGG - Exonic
915453136 1:156020698-156020720 GACCCCCGCCCCCCCGCCCGTGG - Intronic
915463192 1:156081740-156081762 GGCCCCGCCGCCGCCGCCCGCGG - Exonic
915477399 1:156161150-156161172 GTCCCCCGCCCCACCCCGCCAGG - Intronic
915937772 1:160098949-160098971 CTCCCCCGCCCCGCCCCACCAGG + Intergenic
916548433 1:165828035-165828057 GGCCCGCGCGCCTCCGCTCCCGG + Intronic
916694560 1:167221776-167221798 TTCCCCACCCCCGCCGCCCCAGG - Intronic
916773637 1:167937021-167937043 GACCTCAGCGCCTCCGCCCCGGG - Intronic
917755632 1:178094564-178094586 GTCCGACTCGCCGCTGCCCCCGG + Exonic
917813290 1:178681678-178681700 TTCCCCCTCGCCTCAGCCCCTGG - Intergenic
920385747 1:205569318-205569340 CGCCCCCGCCCCGCGGCCCCCGG + Intronic
921317394 1:213905338-213905360 GTCCCTCCCGCTGCAGCCCCGGG + Intergenic
923744307 1:236686413-236686435 GCCCCCGCCGCCACCGCCCCCGG - Intergenic
924511310 1:244730876-244730898 GTGCTGCGCGCCGCCGCGCCGGG + Intergenic
924527085 1:244863103-244863125 GCCCCCCGCCCCGCCCCGCCCGG + Intronic
1063418203 10:5890184-5890206 CTCCGCCCCGCCGCAGCCCCGGG - Intronic
1063418334 10:5890590-5890612 GGCCCCCGCGCTGCCCCCCGAGG + Intronic
1064185904 10:13161640-13161662 GGCCCCGGCCCCGCCGCCCGAGG - Intronic
1064553116 10:16521722-16521744 GTGCCCGCCGCCGCCGCCGCTGG - Exonic
1064981872 10:21173845-21173867 GCCGCCGCCGCCGCCGCCCCCGG - Intronic
1070800471 10:79242291-79242313 GGGCCGCGCGCAGCCGCCCCCGG + Intronic
1071617935 10:87094093-87094115 CTCCCCCGCGCCGTCACCCCGGG - Intronic
1071695294 10:87863516-87863538 GCCCCCTCCGCCGCCGCGCCGGG - Exonic
1071966591 10:90858106-90858128 GTCCCCGCCGCCGCCGCCTCCGG + Intergenic
1072294171 10:93993813-93993835 CTCCCCCGCCCGGCCGCCCGCGG + Intergenic
1073094132 10:100969632-100969654 GACCCCCGGCCCGCAGCCCCAGG - Intronic
1073196437 10:101695146-101695168 GCCGCCACCGCCGCCGCCCCGGG + Exonic
1073207423 10:101776284-101776306 GGCCGCCCCGCCCCCGCCCCGGG - Intronic
1073290058 10:102409101-102409123 GGCCGGCGCGCCGCGGCCCCCGG + Intronic
1073875264 10:107914923-107914945 GAGCCCCGCGCCGCCACCTCGGG - Intergenic
1074843144 10:117374951-117374973 GACCCCCGCCCCGCCGACGCGGG - Exonic
1076554275 10:131311787-131311809 GCCCGCGCCGCCGCCGCCCCCGG + Intergenic
1076734654 10:132453216-132453238 CTGCCCCGCGACCCCGCCCCTGG - Intergenic
1076992097 11:280707-280729 ACCACGCGCGCCGCCGCCCCCGG + Exonic
1076993889 11:289252-289274 GGCCCCCGCCCCGCAGCTCCCGG + Intronic
1077008386 11:369558-369580 GCCCCCCGCCCGGCCGCTCCCGG - Intergenic
1077090838 11:777542-777564 GTCCCACCCGGCTCCGCCCCCGG - Intergenic
1077247435 11:1546538-1546560 GTCGCCCACACCGCGGCCCCAGG - Intergenic
1077477456 11:2797158-2797180 CTCCCCCCCGCCACCCCCCCAGG - Intronic
1078066315 11:8081443-8081465 GGCCCCCGCGCCGGCCCCTCCGG + Intronic
1079630364 11:22666996-22667018 CTCCCCTCCCCCGCCGCCCCGGG - Intronic
1080779795 11:35419552-35419574 ATCACCCGCGCCGCCGCCTCGGG + Intronic
1080873990 11:36260273-36260295 GTCCCCAGCTCAGCCTCCCCGGG + Intergenic
1081831625 11:46120435-46120457 CGCCCCCTCCCCGCCGCCCCCGG + Intronic
1081831978 11:46121710-46121732 GGCCCCCGCGCCTCGGCCCGCGG + Intergenic
1082986123 11:59172465-59172487 GCCCCGCGCCCCGCCGCCCCGGG - Intronic
1083572662 11:63768645-63768667 GCCCCGCGCCCCGCCGCCCCGGG - Exonic
1083595549 11:63916967-63916989 GTCGCCGCCGCCGCCGCCGCCGG - Intergenic
1083657062 11:64234771-64234793 GCCCCCCGCGCCGCCGGGCTAGG + Exonic
1083753872 11:64778577-64778599 GGCCCCGGCCCCGCCGCCCCCGG - Intronic
1083807529 11:65084000-65084022 TCCTCCAGCGCCGCCGCCCCGGG + Exonic
1083970303 11:66070404-66070426 GCCCCCGCCGCCGCCGCCGCGGG + Intronic
1084128675 11:67118136-67118158 TTCCGCCGCGCCGGTGCCCCCGG - Intergenic
1084128768 11:67118441-67118463 GGCCCCGGCGCCGCCGCCACGGG - Intergenic
1084180569 11:67443596-67443618 GTCCCCGGCGGCCCCGCTCCCGG - Intronic
1084295916 11:68213403-68213425 GCCCCCCGCGCCCCCGGCCTCGG + Exonic
1084295985 11:68213616-68213638 CGCCGCCGCGTCGCCGCCCCCGG + Intronic
1084515759 11:69637327-69637349 CTCCCGCGAGCCGCCGCCGCAGG + Intergenic
1084522909 11:69675352-69675374 CTGCCCCGCGCCGCCGCTTCCGG - Intronic
1084591218 11:70091731-70091753 GTCCCACCCACCGGCGCCCCAGG - Intronic
1085011104 11:73142247-73142269 GCCGCCTGCGCCGCCGCTCCCGG + Exonic
1085266804 11:75242163-75242185 GGCTCCCGCGCCACCTCCCCGGG + Exonic
1089432653 11:118436559-118436581 CCCCCCGCCGCCGCCGCCCCCGG - Exonic
1089556248 11:119317227-119317249 GCCCCGCGCGCCGCAGCCCTAGG + Intronic
1089556262 11:119317255-119317277 GGCCCCGGCGCCGCCAGCCCGGG + Intronic
1090375163 11:126283159-126283181 GTCCCCCGCGACCCCGCCCCGGG - Intronic
1091888074 12:4031260-4031282 GCCCGCCGCGCCCCCGCCCGGGG + Intergenic
1092159844 12:6310378-6310400 GTCACCCTCGCCGCCTCCCCCGG + Intergenic
1092230614 12:6773698-6773720 GGCCCGCCCGCTGCCGCCCCCGG + Exonic
1092462344 12:8697847-8697869 GCCCGCCGCGCCGCGGCGCCAGG + Intronic
1093435473 12:19130207-19130229 CTGCCCCGCGCCGCGGGCCCCGG + Intronic
1093894516 12:24562058-24562080 GTCCCCCGGCCAGCCGCCCCCGG + Intergenic
1093931129 12:24956087-24956109 GCCCCCTCCGCCCCCGCCCCGGG + Intergenic
1094041798 12:26126518-26126540 GTCCCCCGGCCCGCCCCGCCGGG + Intronic
1095261790 12:40106111-40106133 GGGCCCCGCCCCGCCGGCCCGGG - Intergenic
1096506641 12:52097941-52097963 CTCTCCCCCGCCCCCGCCCCCGG + Intergenic
1096771728 12:53939653-53939675 GACCCGAGCGCCGCCGCCGCCGG + Intronic
1096784420 12:54009068-54009090 GCCGCCCGCGCCCCAGCCCCGGG + Intronic
1096981070 12:55728553-55728575 GGACCCCGCCCCGCCGCCTCTGG + Intronic
1097083304 12:56449119-56449141 GTCTCCCGCGCCGCGTTCCCGGG - Intronic
1097251089 12:57632652-57632674 GTCCCCCGCGCCGCTTGCCGAGG - Intronic
1097267565 12:57755076-57755098 GTCTCCGCCGCCGCCGCCGCCGG + Exonic
1097267652 12:57755312-57755334 GCCGCCCACCCCGCCGCCCCCGG + Exonic
1097925440 12:65121613-65121635 GTCCCTCGCGGCCCCGCCCCCGG - Intergenic
1099989548 12:89708545-89708567 GTGACCTGCCCCGCCGCCCCCGG + Intronic
1101466797 12:104957967-104957989 GCTCCCCGCGCCCCCGCCGCCGG + Intronic
1102136861 12:110582933-110582955 GTCGCCGCCGCCGCCGCCGCCGG + Exonic
1102254060 12:111406028-111406050 CGCCCCCGGGCCGCCGCCGCCGG - Exonic
1102256491 12:111418464-111418486 GGCCCCGGCCCCGCCGCCCCTGG + Exonic
1102518230 12:113464163-113464185 GACTCCCTCGCTGCCGCCCCCGG - Intronic
1102962010 12:117099194-117099216 GGTCCCCGCGCCGCCCCCCGCGG + Intronic
1103085790 12:118061117-118061139 CGCCCCCGCGCCGCCCGCCCCGG + Intronic
1104412553 12:128571557-128571579 CTCCCCCTCCCCGCAGCCCCTGG + Intronic
1104904400 12:132205592-132205614 GTCCGCGGCGCCGCCGTGCCAGG + Exonic
1105328335 13:19390868-19390890 CTCCCCCGCGCAGCCACACCTGG + Intergenic
1105801084 13:23903723-23903745 GCCTCCCGCGCCTCCGCCCCAGG + Intergenic
1108389657 13:49936066-49936088 GTCCCCCTGCCCGCCGCGCCCGG + Intronic
1108701452 13:52947795-52947817 GTCCCTCCCGCCCCTGCCCCTGG + Intergenic
1112580686 13:100674555-100674577 GTCCCCCGTGACCCCGGCCCGGG + Intronic
1112652720 13:101416346-101416368 GTCGCCGCCGCCGCCGCCCGCGG - Exonic
1112752561 13:102597224-102597246 GCCGCCCGCGCCCCCGCGCCCGG - Intronic
1114270703 14:21098421-21098443 GGCCCCGGCCCCCCCGCCCCCGG + Exonic
1115028399 14:28767498-28767520 GCCGCCGCCGCCGCCGCCCCCGG + Exonic
1115174538 14:30547539-30547561 GTCCCTTGCTCCGCCGCACCCGG - Intergenic
1115851917 14:37595637-37595659 GTCTCCGACGCCACCGCCCCCGG - Intronic
1117837208 14:59819630-59819652 GTCCCCTGCTCCGCAGCGCCCGG - Intronic
1119643768 14:76334201-76334223 GTCCCCCTCGCCACCCACCCAGG - Intronic
1119696031 14:76714081-76714103 GTCCCCAGAACCGCCTCCCCTGG - Intergenic
1122230870 14:100305880-100305902 GCCCCCCGCGCCGAGGTCCCGGG - Intronic
1122470800 14:101964702-101964724 GTCCTCGCCGCCGCCGCCCCCGG - Exonic
1122959186 14:105086898-105086920 GTCCCCAGCCCCGCCGGTCCCGG + Intergenic
1122978562 14:105181088-105181110 GTCCCCCGCGCCCCCGCCGGCGG - Intronic
1123023989 14:105415058-105415080 CTACCCCGCGCGGCCGCCCGTGG - Intronic
1124584479 15:30991985-30992007 ACGCCCCGCGCCGCCGTCCCAGG - Intergenic
1125180993 15:36880717-36880739 CTCTCCCGCGCCCCAGCCCCGGG + Intergenic
1125937525 15:43649331-43649353 GTTCCCCGCGCCCTCGCCCCCGG - Intronic
1125950423 15:43746751-43746773 GTTCCCCGCGCTCTCGCCCCCGG - Intronic
1129424546 15:75454453-75454475 GGCCCCTGCGCCGCCTCTCCCGG + Intronic
1129447009 15:75625682-75625704 GTCGCACGCGCCGCCGCCACCGG + Exonic
1129483031 15:75843134-75843156 CCCCCGCGCGCCCCCGCCCCCGG - Intergenic
1131085901 15:89575564-89575586 ATCGGCCGTGCCGCCGCCCCGGG - Exonic
1131228226 15:90642557-90642579 CTCTCCGGTGCCGCCGCCCCAGG - Exonic
1132344291 15:101098941-101098963 TTCCCCCTCCCCGCAGCCCCTGG - Intergenic
1132365092 15:101251471-101251493 GCCCGCCGGGCCGCCGCCGCAGG + Exonic
1132519823 16:381952-381974 GTCCCCGCCGCCGTCGCCCCGGG + Exonic
1132579065 16:676900-676922 GGCCCCCCGGCCGCTGCCCCGGG + Intronic
1132656569 16:1044047-1044069 GCCCCCGCCGCCGCCGGCCCAGG - Intergenic
1132683568 16:1153325-1153347 GCCCCCAGCGCCTCCGCCCCCGG - Exonic
1132683587 16:1153359-1153381 GCCCCCAGCGCCTCCGCCCCCGG - Exonic
1132724824 16:1334092-1334114 GACCCCCGCGCCTCCCTCCCCGG + Intronic
1132741366 16:1414826-1414848 GCCCCCCGCAGCCCCGCCCCCGG + Intergenic
1132779415 16:1614454-1614476 CGCCCCCACGCCGCCGCCCCCGG - Intronic
1132831245 16:1929540-1929562 GCCACCCCCGCCCCCGCCCCTGG + Intergenic
1132851515 16:2026960-2026982 CTCCCCCGCGCCCCTGCCCGCGG + Exonic
1132943629 16:2520553-2520575 GTCCCCAGCCCCGCAGTCCCCGG - Intronic
1133219923 16:4315651-4315673 CCCCCCCGCGGCCCCGCCCCCGG - Intronic
1134143633 16:11742849-11742871 GTCAGCCGCGCCGCCGCCGCGGG + Exonic
1135296515 16:21283860-21283882 GCCCGCCGCGCAGCCGCCCGCGG - Intronic
1135607501 16:23836606-23836628 GGCTCCCGCGACGCCGCCCCTGG - Intronic
1135821972 16:25692705-25692727 GCCGCCCGCGCCGCCGCCGCTGG + Exonic
1136365181 16:29806422-29806444 GCCGCCCGGGCCCCCGCCCCCGG + Intronic
1136453960 16:30370105-30370127 GGCCCCCTCGCCGCCGCCCCGGG - Exonic
1136784283 16:32925519-32925541 GCCCCCGCCGCCGCCGGCCCGGG - Intergenic
1136885501 16:33928287-33928309 GCCCCCGCCGCCGCCGGCCCGGG + Intergenic
1136891529 16:33975586-33975608 GTGGCCCGCGCCCCCGGCCCCGG - Intergenic
1137288782 16:47037750-47037772 GTCCTCCCAGCCGCCGCCTCCGG - Intergenic
1137553777 16:49457392-49457414 GGCTCCCGGGCCGCTGCCCCTGG - Intergenic
1137683271 16:50368966-50368988 GCCCCCCCCGCCGCCGCTCTCGG - Intergenic
1139473745 16:67192242-67192264 GCCACAGGCGCCGCCGCCCCCGG + Exonic
1139593025 16:67943718-67943740 GTCCCCCACTCCGCCCCCCCTGG + Exonic
1139615441 16:68085747-68085769 GGCGCCGGCGCCGCCGCCCCCGG + Exonic
1139806052 16:69566189-69566211 CGCCCTCGCGTCGCCGCCCCCGG + Exonic
1140223112 16:73058194-73058216 CGGCCCCGCGCCGCCGCCGCCGG - Intronic
1140701697 16:77587341-77587363 GCCCCCCGGCCCGCCACCCCAGG + Intergenic
1141538643 16:84700456-84700478 AGCCCCCGGGCCGCCTCCCCCGG - Intronic
1141582727 16:85011329-85011351 GTCGCCGCCGCCGCCGCCGCAGG - Exonic
1141682534 16:85553134-85553156 GCCCCCCGCCCCGCCCCCCAGGG + Intergenic
1141828633 16:86497617-86497639 GCCCGCCCCGCCCCCGCCCCCGG + Intergenic
1142188473 16:88706134-88706156 GGCCCCCTCCCCGCGGCCCCTGG + Intronic
1142231494 16:88902189-88902211 GTCCCCCGCCCCCCAGCCCAGGG - Intronic
1142367548 16:89657971-89657993 GCTCCCCGCGTCTCCGCCCCTGG + Intronic
1203081503 16_KI270728v1_random:1148020-1148042 GTGGCCCGCGCCCCCGGCCCCGG + Intergenic
1203086940 16_KI270728v1_random:1189525-1189547 GCCCCCGCCGCCGCCGGCCCGGG - Intergenic
1142812288 17:2401002-2401024 GCCTCCCGCCCCGCGGCCCCCGG + Exonic
1143485364 17:7251303-7251325 GACCCCGGCACCGCCGGCCCCGG + Exonic
1143544772 17:7589538-7589560 GGCCCCCGGGACGCTGCCCCTGG - Exonic
1143625984 17:8110360-8110382 GAGCCCGGCGCCGCCGCCCCGGG - Intronic
1144339743 17:14301675-14301697 GGCTCCTGCGCCGCCGCGCCGGG + Exonic
1144586904 17:16492417-16492439 CGCCCCCGCGCCACGGCCCCGGG - Intergenic
1144658207 17:17051532-17051554 CTCCCCCGCCACCCCGCCCCAGG - Intronic
1145248273 17:21283962-21283984 GTCGCCCGCGCCCGCGCTCCAGG - Intergenic
1145828220 17:27893269-27893291 TGCCCCCGCGCCCCCGCCCTCGG + Intronic
1145970164 17:28951483-28951505 GCCACCCGCGCAGGCGCCCCGGG + Exonic
1146058691 17:29593534-29593556 GCCCCCCGCCCCGCGGCCCCGGG + Exonic
1146445297 17:32928094-32928116 CGCCCCCGCGCCCCGGCCCCCGG - Exonic
1147123712 17:38351960-38351982 GCCCCGCCCGCCGCGGCCCCCGG - Intergenic
1147144574 17:38477666-38477688 GCCCCCGCCGCCGCCGGCCCGGG - Exonic
1147187776 17:38722043-38722065 GCCCCCAGCCCCGCTGCCCCGGG - Exonic
1147200646 17:38799426-38799448 GCCGCCGCCGCCGCCGCCCCGGG - Exonic
1147994629 17:44354041-44354063 GCCGCCCGCGCCCCCGCGCCTGG - Exonic
1148262237 17:46193548-46193570 GCCCGCCGCGCCGCCCCCGCGGG + Intronic
1148556598 17:48582232-48582254 CTCCTCCGCGCCGCCGCCGCCGG - Intronic
1148680389 17:49470330-49470352 CTCCCCCGCGCCTCCCGCCCAGG + Intronic
1148842552 17:50508360-50508382 GTCCCCCGCCCCGCCCCGCCCGG + Intergenic
1149314018 17:55421941-55421963 CTCCCCGGCTCCTCCGCCCCGGG + Exonic
1150150927 17:62808288-62808310 GCCCCCACCGCCTCCGCCCCAGG - Exonic
1151559169 17:74861553-74861575 CGCCCCCGCCCCGCCGCGCCCGG - Intergenic
1151570502 17:74923267-74923289 GCCCCCTCCGCCCCCGCCCCCGG - Intergenic
1151673884 17:75588362-75588384 GCGCCCCCCGCGGCCGCCCCTGG - Intergenic
1152205828 17:78973968-78973990 GTGCTCCCCGCCGCCTCCCCTGG + Intronic
1152362431 17:79838963-79838985 GAGCCCCGCGCCTCGGCCCCCGG + Intronic
1152546784 17:81004212-81004234 GCTTCCCGCGCCGCCGCCCCGGG - Intronic
1152627919 17:81396731-81396753 GTCCCTCTTGCCGCGGCCCCAGG - Intronic
1152652147 17:81499690-81499712 GTCCCCCGACCCTCCGCCCCAGG + Intergenic
1152719782 17:81917850-81917872 GGCCCTCGCGCCGCCGGCTCCGG + Exonic
1152834399 17:82519932-82519954 GCCCCCGGCCCCGCCGCCCGCGG - Exonic
1152834408 17:82519947-82519969 GCCCCCGGCCCCGCCGCCCCCGG - Exonic
1154255789 18:12779836-12779858 GTTCCCCGCGCCTCCTCCGCAGG + Intergenic
1157383816 18:47246660-47246682 CCCGCCCCCGCCGCCGCCCCTGG - Intronic
1157384053 18:47247480-47247502 GTCCCCGCCGCTGCCGCCCGGGG + Intronic
1157662750 18:49460267-49460289 GGTCCCTTCGCCGCCGCCCCGGG + Intronic
1158954159 18:62523598-62523620 GCCGCCGCCGCCGCCGCCCCGGG + Exonic
1159045714 18:63367138-63367160 GGCCCCCGCCCGGCCGCTCCGGG - Exonic
1159511293 18:69400925-69400947 CCCCACCGCGCCGCCGCCCCCGG - Intergenic
1160163166 18:76491163-76491185 CTCCGCCGCGCCTCGGCCCCCGG + Intronic
1160177874 18:76610997-76611019 CTCCCCGGCCCCGCCACCCCAGG - Intergenic
1160204661 18:76822751-76822773 CGCCCCCGCCCCGCCGCTCCCGG - Intronic
1160242363 18:77132820-77132842 CTCCCCGGCCCCGCCTCCCCGGG + Intronic
1160453343 18:78979745-78979767 GCCCCCCCCGCCGCCGCCGCCGG - Intergenic
1160486827 18:79300588-79300610 GTCCACGGCCCCGCAGCCCCGGG - Intronic
1160659270 19:290878-290900 GACGTCCGCGCCTCCGCCCCTGG - Intronic
1160882060 19:1325383-1325405 CTTCCCCGCGCAGGCGCCCCCGG - Intergenic
1160947874 19:1652014-1652036 GCCCCCCGCGCCCCCGCCCGGGG + Intronic
1160952852 19:1675874-1675896 GGCCCCCTCCCCGCCGGCCCGGG + Intergenic
1161022140 19:2015537-2015559 GCCGCCGCCGCCGCCGCCCCTGG - Exonic
1161051067 19:2164301-2164323 CTCCCCTCCTCCGCCGCCCCTGG + Intronic
1161077232 19:2291713-2291735 GCTGCCCGCGGCGCCGCCCCCGG - Exonic
1161101507 19:2424171-2424193 GTTCCCGGCGCCGCAGCCACAGG - Exonic
1161157415 19:2739900-2739922 CCGCCCCGCCCCGCCGCCCCAGG + Intronic
1161400694 19:4065436-4065458 GGCCCCCTCGCCGCTGCCCCGGG - Intronic
1161959613 19:7516363-7516385 GCCCTGCGCGCCGCCGGCCCTGG + Intronic
1162145536 19:8610739-8610761 CTTCCCCGCGCCCCCTCCCCTGG - Intergenic
1162374428 19:10296357-10296379 GCCCCCCGCCGCGCCGCCCACGG - Exonic
1162775300 19:12975455-12975477 GGCCCCTGCCCCGCCCCCCCAGG + Intergenic
1163478169 19:17539270-17539292 GTGCCCCGCGAGGCCGCACCCGG + Intronic
1163548392 19:17952179-17952201 GGGCCCCGCCCCGCCGCCCGGGG - Intronic
1163551175 19:17967167-17967189 GCCCCCGGCCCCGCCGCCCCCGG + Intronic
1163607100 19:18281492-18281514 CTCCCCCGCCGCGCCGGCCCGGG + Exonic
1163729565 19:18941257-18941279 GCCGCCCGCCCCGCCTCCCCGGG + Intronic
1163743880 19:19033458-19033480 GCCACCCCCGCCGCCGCCTCAGG + Intronic
1164639214 19:29812247-29812269 GCGCCCCGCGACGCCGCCCGGGG - Intronic
1164834755 19:31349894-31349916 GGGCGCCGCGCCCCCGCCCCCGG + Intergenic
1165412919 19:35673361-35673383 GACCTCCGCCCCGCCGCGCCGGG - Intronic
1165454028 19:35900512-35900534 TTCCCCCGCGGAGCCGCCGCCGG + Exonic
1165493945 19:36141118-36141140 GCCGCCGCCGCCGCCGCCCCCGG - Exonic
1165775730 19:38403351-38403373 GCGCCCCGCGACGCCGCCCCCGG - Exonic
1165942777 19:39423576-39423598 ATGCCCCGCGCCGCCGGCCTCGG + Exonic
1166306858 19:41940250-41940272 AACCCCCGCCCCTCCGCCCCCGG - Intergenic
1166361326 19:42254039-42254061 CTCCCCTCCCCCGCCGCCCCCGG - Intronic
1166524684 19:43503874-43503896 GCCCCCCGCGCTGTCGCCCTCGG + Intronic
1166838413 19:45681675-45681697 GTACCCCGCGCTGCCGCCAGAGG - Intronic
1166876538 19:45901388-45901410 GCCCCCGGCGCCGCCACACCTGG + Exonic
1167040283 19:47019753-47019775 GCCCGCCGCGTCTCCGCCCCCGG - Intergenic
1167238055 19:48326808-48326830 GTCCCCTGCTCCCCCTCCCCAGG + Exonic
1167921533 19:52786667-52786689 GTCCCCGGCGCTTCTGCCCCTGG - Exonic
1168072973 19:53963014-53963036 CTCCCCAGCCCCGCCGGCCCCGG + Intergenic
1168076348 19:53982599-53982621 GCCGCCTCCGCCGCCGCCCCCGG - Exonic
1168081236 19:54012065-54012087 GGCCCCCACGCCGCAGCCCAGGG - Exonic
1168280823 19:55304651-55304673 CTCCCCGGCGCCCCCACCCCTGG - Exonic
1168308973 19:55451412-55451434 TCTCCCCGCCCCGCCGCCCCTGG - Intergenic
1168309352 19:55452703-55452725 GCCCCCCACGCCGCCACCCCCGG - Intergenic
1168466724 19:56608281-56608303 ATCCCCCTCCCCTCCGCCCCTGG + Intronic
1168652154 19:58098141-58098163 GACCCCCGCGCTGCATCCCCGGG + Intronic
925082328 2:1080083-1080105 GTCCCCCTCGCCACCGCCCTGGG - Intronic
925959906 2:9004235-9004257 GTCCCTCCGGCCGCCACCCCGGG - Intergenic
926018292 2:9473782-9473804 GGCCTCTGCGCCGGCGCCCCTGG + Intronic
927714985 2:25345978-25346000 TTCCCCCTCCCCGCAGCCCCTGG - Intergenic
929107251 2:38377197-38377219 GTCGCCGGCGCCACAGCCCCTGG + Exonic
929452705 2:42047876-42047898 GTCCTCGGCGCCGCCCCCTCCGG - Intergenic
929766369 2:44847278-44847300 TTCCCCCTCGCCCCAGCCCCTGG + Intergenic
929983191 2:46699493-46699515 GGCCCCCGCGCCGTCGTCCGCGG + Intronic
930135909 2:47904920-47904942 TTCCCCCGCCCCCCCGTCCCTGG - Intronic
930189268 2:48441038-48441060 GTCCCCCGCCCTGCGGCCTCAGG + Intronic
930358223 2:50346884-50346906 GCCGCCGCCGCCGCCGCCCCCGG + Intronic
932036689 2:68252750-68252772 GACGTCCGCGCCCCCGCCCCTGG - Intronic
932239081 2:70142860-70142882 CTCGCCCGCGCCGCCGCTTCCGG - Intergenic
932757530 2:74418564-74418586 GTCTCCACCGCAGCCGCCCCTGG + Intronic
934079113 2:88452453-88452475 GCCGCCACCGCCGCCGCCCCGGG - Exonic
934921125 2:98346424-98346446 CTCCCCCGCGCTCCCGGCCCAGG - Exonic
935250075 2:101253110-101253132 GCCCCCCGGGCCTCCGCTCCCGG - Exonic
935354756 2:102187784-102187806 GTCGCCCACGCCGGCGCCTCGGG + Intronic
935997191 2:108786975-108786997 GTGCCCCGCGCAGCCGGCCTGGG + Intronic
936122699 2:109760437-109760459 GCCGCCGCCGCCGCCGCCCCCGG - Intergenic
936452800 2:112646036-112646058 GTCCCCGGTGCCGCCGACCCGGG + Exonic
936556777 2:113503430-113503452 GGCCTCTGCGCCACCGCCCCCGG + Intergenic
938397858 2:130963978-130964000 GGCCGCCGCACCGCCGCCCCCGG + Intronic
939629634 2:144516843-144516865 GCCACCCCCGCCCCCGCCCCGGG + Intronic
941666224 2:168246777-168246799 GTCCCCCAGGACGCGGCCCCCGG + Intronic
942170271 2:173282851-173282873 GTCGGCCGCGCTGCCGGCCCCGG - Intergenic
942461672 2:176172412-176172434 GTCGCCTGCGCCTCCGCCGCTGG - Exonic
946231258 2:218292430-218292452 GTCCCCAACGGCGCCGGCCCCGG + Intronic
946747558 2:222861168-222861190 ACGCCCCGCGCCGCCGCCCGGGG - Exonic
946908974 2:224442327-224442349 CTCGGCCGCGCCGCCGGCCCGGG - Intergenic
948393263 2:237627409-237627431 GTCCCCCGCCCCGCCGTCCCTGG + Intergenic
948458924 2:238119872-238119894 GTCCCCCCCACCCCAGCCCCTGG + Intronic
948628252 2:239283990-239284012 GGCCCCTGCGCCGACGCCCTTGG - Intronic
1168753081 20:297591-297613 TTCCTCCGCGCCGCCGCCGGTGG - Exonic
1168769789 20:408007-408029 GGCCCCCCCGGCCCCGCCCCCGG + Intronic
1168854946 20:1001999-1002021 GCCCCCAGAGCCGCCGCCCCCGG + Intronic
1169204475 20:3732345-3732367 CTCCCCCGCCCCGCCCCCACAGG - Intergenic
1169214728 20:3786511-3786533 GGCGCCGCCGCCGCCGCCCCGGG + Exonic
1170756810 20:19212495-19212517 CCCCGCCGCGCCGCCGCCCCAGG + Intergenic
1171481910 20:25460756-25460778 GTCCCCCCCGGCGCTGGCCCTGG - Intronic
1171499830 20:25585172-25585194 GGCGCCCGCGCCGCCGCCGTCGG + Intronic
1173704203 20:45098151-45098173 GCCGCCTGCGCCGCCGCCTCTGG - Exonic
1173822698 20:46029409-46029431 GCCCCCTCCCCCGCCGCCCCCGG - Intronic
1173916086 20:46709651-46709673 GTCCCCAACGCCGCTGCCGCCGG - Exonic
1174204265 20:48827813-48827835 GTCCCCGGCCCCGTCGCCGCCGG + Exonic
1174386397 20:50190590-50190612 CACCCCCGCCCGGCCGCCCCGGG - Intergenic
1174386560 20:50191165-50191187 GGCCCCCGCGGCGCCCCCCGCGG + Exonic
1174586793 20:51615086-51615108 ACCCCCCGCCCCGCCCCCCCAGG - Intronic
1175399480 20:58692597-58692619 GCCTCCAGCGGCGCCGCCCCTGG - Exonic
1175856000 20:62121640-62121662 GGCCTCCGGGCCGCAGCCCCGGG + Intergenic
1176159427 20:63640949-63640971 GTCCTCTGAGCCGGCGCCCCTGG - Exonic
1176223140 20:63979417-63979439 GCCCCCCGCGTGGCCGCGCCGGG - Exonic
1176545624 21:8196759-8196781 GCCCCCCGCCCCGGAGCCCCAGG + Intergenic
1176564575 21:8379804-8379826 GCCCCCCGCCCCGGAGCCCCAGG + Intergenic
1178680521 21:34669593-34669615 GTGCCCCGCGCCTCGGCCTCCGG - Exonic
1179243833 21:39613074-39613096 GCGCCCCGCGCCCCAGCCCCGGG - Intronic
1179561592 21:42219237-42219259 GCCGCCGCCGCCGCCGCCCCCGG + Exonic
1180801590 22:18634488-18634510 GTCCCCCGCGCCGCGCCCCGCGG + Intergenic
1180843798 22:18970905-18970927 GACCCCCGGGCCGCCACCCCCGG - Intergenic
1180852833 22:19030027-19030049 GTCCCCCGCGCCGCGCCCCGCGG + Intergenic
1180871787 22:19150561-19150583 GGCCGCCTCGCCGCCGCCCGCGG + Intergenic
1180962037 22:19766500-19766522 GCCGCCGGCGCCGCCGGCCCCGG - Exonic
1181175463 22:21032433-21032455 CTCCGCCGCGCCCCCGTCCCCGG + Intronic
1181220132 22:21360773-21360795 GTCCCCCGCGCCACGCCCCGCGG - Intergenic
1181634619 22:24168909-24168931 GCCCCCCGCCCCACCGCCCCAGG + Intronic
1181652960 22:24271043-24271065 GCCGCCCGCGCTGCCGCGCCCGG + Intronic
1181778935 22:25178920-25178942 GTCCTCTGAGCCGGCGCCCCTGG - Intronic
1182035151 22:27192582-27192604 GTCCCCAGCGCAGCCCCCCTTGG - Intergenic
1182355464 22:29720599-29720621 GCCCCCCGCCCCCGCGCCCCTGG - Intronic
1182424739 22:30266080-30266102 GGCACCCTCGCCGCCTCCCCAGG + Intronic
1183149732 22:36028364-36028386 GGGCCCGGCGCCGCCGCCCGGGG - Exonic
1183342225 22:37287695-37287717 GACCCCCACGCCTCTGCCCCAGG - Intronic
1183517136 22:38273045-38273067 GTCCGCCGCCCCGCCCTCCCCGG - Intergenic
1183665567 22:39244119-39244141 CCCCCGGGCGCCGCCGCCCCCGG + Exonic
1184086833 22:42270465-42270487 GCCCGCCCCGCCGCCGGCCCGGG - Intronic
1184184660 22:42856860-42856882 TGTGCCCGCGCCGCCGCCCCCGG + Intronic
1184568860 22:45309845-45309867 GTCCCCGGAGGCCCCGCCCCGGG - Intronic
1184593888 22:45502911-45502933 GGAGCCCGCGCCGCTGCCCCAGG + Exonic
1184612208 22:45611778-45611800 GTCCCCCTCGCCCCAGGCCCTGG - Intergenic
1184693190 22:46126635-46126657 GTGCCCTGGGCCGCCGCCCCAGG + Intergenic
1184778514 22:46635184-46635206 GTCCTCCCTGCCCCCGCCCCCGG + Intronic
1184778553 22:46635276-46635298 GTCCTCCCTGCCCCCGCCCCCGG + Intronic
1184778665 22:46635552-46635574 GTCCTCCCTGCCCCCGCCCCCGG + Intronic
1185055361 22:48576115-48576137 ATCAGCCCCGCCGCCGCCCCCGG - Intronic
1185259364 22:49853318-49853340 GCTCCCCGCGCGGCCCCCCCGGG - Intergenic
1185413432 22:50697579-50697601 GCCCCCCGCACCGCCGCCCCGGG + Intergenic
1185420278 22:50731058-50731080 GGCCCCGGCCCCGGCGCCCCCGG + Intergenic
1203250495 22_KI270733v1_random:112996-113018 GCCCCCCGCCCCGGAGCCCCAGG + Intergenic
950316389 3:12004933-12004955 GTGCCGGGCGCCGCCGCCCTCGG + Intronic
951803511 3:26622937-26622959 GTGCCCCGCACGGCCGCCCGGGG + Exonic
953427205 3:42804794-42804816 GTCCCGAGCGCCGCCGCCTGCGG + Intronic
954202023 3:49029149-49029171 GTCCCCCACGCCCACGCCCAAGG + Intronic
956420213 3:69079951-69079973 GATCCCCGCCCCGCAGCCCCGGG - Intronic
956678107 3:71753950-71753972 CTCCGCCGCTCCGCCGGCCCTGG - Intronic
956681465 3:71785322-71785344 GCCCCCCGCGCCCCCGCCTCGGG + Intergenic
960115087 3:113885269-113885291 GACCCCGGCACCGCCGGCCCCGG - Intronic
961876238 3:130025790-130025812 CTCCCCCGCTCCCCCGGCCCCGG - Intergenic
962301848 3:134250495-134250517 CGCCCCCGCCCCGCGGCCCCCGG - Exonic
962344629 3:134610221-134610243 GTCCACCAGGCCGCTGCCCCAGG + Exonic
963107620 3:141660273-141660295 CTCCCCGGCGCCGGCGCCCTGGG + Intergenic
963236737 3:142963695-142963717 GCCTCCGCCGCCGCCGCCCCCGG + Intergenic
966592241 3:181695879-181695901 GTCGGCCCCGCCGCGGCCCCAGG + Intergenic
968008853 3:195260209-195260231 GTGCCCCGCGCGGCCGCCTGGGG - Intronic
968066439 3:195762011-195762033 GACCCCCACGCCGGCGGCCCGGG - Intronic
968514827 4:1011677-1011699 GCCCCTCGCCCCGCCGCCCCGGG + Intronic
968606377 4:1537619-1537641 GGCCCTGGCGCCGCCGCCCTTGG - Intergenic
972396393 4:38663304-38663326 GTCCCCCTGGCCGGCGGCCCAGG - Intergenic
972586044 4:40437880-40437902 CTCAGCCGCGCCGCCGCCCCTGG + Exonic
972765728 4:42151470-42151492 TTCTCCAGCGCCGCCGCGCCTGG - Intronic
976246447 4:83010678-83010700 GTCGCCGTCGCCGCCGCCTCTGG + Exonic
979205543 4:118033556-118033578 GGCCCGCGCGCGCCCGCCCCGGG - Intergenic
979455637 4:120922834-120922856 GCCCCCCGCGCCCCCGCAGCAGG - Exonic
979674813 4:123398792-123398814 GGCCACCGCGCCGCCGCTCCGGG - Intronic
980130399 4:128811709-128811731 GGCCGCTGCGCCCCCGCCCCGGG + Intronic
981429798 4:144645871-144645893 GCCCGCCTCGCCGCGGCCCCCGG - Intergenic
981782399 4:148443778-148443800 GTCCCCCGGTCCCCCGCCTCGGG - Intronic
985550047 5:528341-528363 GTCCCCCGCGCCATTGCCCTGGG - Intergenic
985580486 5:693233-693255 GCCCCCCGCGCCGCGCCCGCGGG + Intronic
985595144 5:784623-784645 GCCCCCCGCGCCGCGCCCGCAGG + Intergenic
985630071 5:1009451-1009473 GTTTCCCGCGCGTCCGCCCCCGG + Intronic
985656689 5:1135489-1135511 GTCCCCAGCCCTGCTGCCCCGGG + Intergenic
985703211 5:1386078-1386100 CTCCCCCGCGCCTGTGCCCCGGG + Intergenic
986013870 5:3740718-3740740 GTCCCCCGCGGGCCCTCCCCTGG + Intergenic
987050699 5:14144581-14144603 CAGCCCCGCGCCGCCCCCCCGGG - Intronic
987099845 5:14581971-14581993 GCCCCCCGCCCCGCCCCGCCCGG - Intronic
987132480 5:14872046-14872068 GCCCTCAGCGCCGCCGCCCCCGG - Intergenic
987193242 5:15500354-15500376 GCTCACCGCGCCGCCGCCGCCGG - Exonic
987374030 5:17217877-17217899 GCGCCCCGCCCCGCAGCCCCCGG + Intronic
990175993 5:53109547-53109569 GGCGCCCCCGCCCCCGCCCCCGG - Exonic
990825428 5:59893355-59893377 GCCGCCCCCGCCGCCGCCCGGGG - Exonic
990955105 5:61332658-61332680 GCCGCCCGCGGCGCCGCCGCCGG - Exonic
992042433 5:72848699-72848721 GCCCCACGCGGCGGCGCCCCCGG - Intronic
992111546 5:73498720-73498742 GCCCCCAGGGCAGCCGCCCCTGG - Exonic
992527659 5:77628366-77628388 GCCCTCCGCGCCACTGCCCCAGG + Intergenic
992530233 5:77645705-77645727 GTCTCCCGCGCCGTCGGGCCGGG + Intergenic
992561651 5:77958196-77958218 CAGCCCCGCGCCTCCGCCCCGGG + Intergenic
992769675 5:80035422-80035444 GTCACCTGCGGCGCCGGCCCGGG + Exonic
994043535 5:95284392-95284414 GTCGCCCTCCCCGCCACCCCCGG - Exonic
994710426 5:103258842-103258864 GTCTCCCGCTCCGCAGCCCCGGG + Exonic
996308539 5:122077753-122077775 GACCCGGGCGCCGCCGTCCCTGG - Exonic
996404291 5:123090635-123090657 GGCGCCGGCGCCGGCGCCCCGGG - Intronic
997470581 5:134114923-134114945 GCCGCCCGCGCCGCCCCCGCCGG - Exonic
997479912 5:134177111-134177133 ATCCCCCGGCCAGCCGCCCCCGG - Intronic
998530673 5:142881414-142881436 CACCCCCCAGCCGCCGCCCCGGG - Intronic
998583615 5:143404195-143404217 GTGGCCCGCGCCGCCGCCGCCGG + Intronic
999261657 5:150242137-150242159 GTCCCCCTCCCGGCCACCCCAGG - Intronic
999696237 5:154190641-154190663 GTCGCCGCCGCCACCGCCCCCGG - Intronic
1002082253 5:176744028-176744050 GTCCCCTGCCCCGGCCCCCCGGG - Intergenic
1002190094 5:177473411-177473433 GAGCCCCCCGCCCCCGCCCCCGG - Intronic
1002669520 5:180855454-180855476 GCCCTCCGCGCTGCTGCCCCTGG + Intronic
1002670298 5:180861181-180861203 GCCGCCCGCGCTCCCGCCCCCGG - Intronic
1002898159 6:1390846-1390868 GTCGCCGCCGCCGCCGCCCCCGG - Exonic
1003099033 6:3163113-3163135 TCCCCCTGCGCCGCGGCCCCTGG - Intergenic
1003545025 6:7051873-7051895 CTCCCCCGCGCCACCGGGCCGGG - Intergenic
1005987560 6:30884209-30884231 GCCGCCCGCGCCGCTGCCTCCGG - Intronic
1006168393 6:32079282-32079304 GTCCCCCGAGGAGCCGCTCCTGG - Intronic
1006436398 6:34027988-34028010 GTGTCCCCCGCCGCCTCCCCAGG + Intronic
1007390264 6:41546556-41546578 GACCCCGGCGTCCCCGCCCCCGG - Exonic
1007544343 6:42680875-42680897 AGCCACCGCGCCCCCGCCCCAGG - Intronic
1007775732 6:44223490-44223512 GACGCCCGCGGCCCCGCCCCCGG - Intronic
1010980583 6:82364978-82365000 GTCCCCGGCGGCGGGGCCCCGGG - Exonic
1013272566 6:108558125-108558147 GCCCCCAGCCCCGCCGCTCCGGG + Intergenic
1014137854 6:117908337-117908359 GTCCTCCGCCCCGCCCCGCCCGG + Intronic
1015366315 6:132401365-132401387 GAGCCCCCCGCCGCCGTCCCGGG + Exonic
1015976437 6:138795993-138796015 GCCCCTCCCGCCGCCGCGCCCGG - Intronic
1017793625 6:157823034-157823056 GCCGCCGCCGCCGCCGCCCCCGG - Intronic
1017793634 6:157823068-157823090 CCGCGCCGCGCCGCCGCCCCGGG - Intronic
1018150287 6:160931186-160931208 CCCACCCGCGCCCCCGCCCCGGG - Intergenic
1019379092 7:712159-712181 GCCCCCCGCCACGCCGCCCCCGG + Intronic
1019395688 7:816651-816673 CTGCCTCGCGCCGCCGCCTCAGG - Intronic
1019474299 7:1236626-1236648 GCCGCCCGCGCCGCCTGCCCAGG + Exonic
1019551020 7:1602598-1602620 GACCCCCGCGGCCCCGCACCTGG + Intergenic
1019776410 7:2914160-2914182 GTCCCCCACCCCGCTGGCCCTGG - Intronic
1020046709 7:5046060-5046082 GGCCCCAGCGCCGCCGGCTCCGG - Exonic
1020086322 7:5312709-5312731 GACGCCCGCGCCCCAGCCCCAGG - Exonic
1020137364 7:5594518-5594540 CTCCCCCGCCCCGCCGCATCTGG - Intronic
1020274326 7:6615595-6615617 GGCCCCCGCGCCCCCGCCCCCGG + Exonic
1021510448 7:21427859-21427881 GGCCCCAGCGCCCCGGCCCCCGG + Intergenic
1022375282 7:29806607-29806629 GTCTCCGCCGCCGCCGCCTCCGG - Exonic
1022698028 7:32728749-32728771 GGCCACCGCGGCGCCGCCCGAGG - Intergenic
1023016341 7:35971602-35971624 GTTCCCTGCGCCGCCGCCTTCGG + Intergenic
1023842273 7:44104318-44104340 AGCCCCGGCGCCCCCGCCCCGGG + Intergenic
1024283042 7:47735233-47735255 TCCCCCCGCTCCACCGCCCCTGG - Intronic
1025207900 7:57004023-57004045 GCCCCCGGCGCCACGGCCCCCGG - Intergenic
1025207985 7:57004363-57004385 GACGCCCGCGCCCCAGCCCCAGG + Intergenic
1025608193 7:63054399-63054421 GTCCGCCGCGGCGCAGCCGCCGG + Intergenic
1025663966 7:63572512-63572534 GACGCCCGCGCCCCAGCCCCAGG - Intergenic
1025712572 7:63926350-63926372 GCGCCCCGCGCTGCCCCCCCAGG - Intergenic
1026904981 7:74057701-74057723 GTCCCCCTCACCCCCGCCACTGG + Intronic
1027116566 7:75486078-75486100 GGCCCCAGCGCCGCCGGCTCCGG + Exonic
1027121892 7:75527899-75527921 GGCCCCAGCGCCGCCGACTCCGG + Intergenic
1027275235 7:76549532-76549554 GGCCCCAGCGCCGCCGGCTCCGG - Intergenic
1028621485 7:92833563-92833585 GTCGCCGCCGCCGCCGCCGCCGG + Exonic
1028922341 7:96322038-96322060 GCCCCCACCGCCGCCGCCGCCGG - Exonic
1029720944 7:102364082-102364104 GGCCCCAGCGCCGCCGGCTCCGG - Exonic
1031629950 7:124033323-124033345 AGCCCCGGCGCCGCCTCCCCTGG - Intergenic
1031899447 7:127392873-127392895 GGCCCTCGCGCCGGCGGCCCCGG - Intronic
1032387799 7:131536644-131536666 GTCCCCAGCGCCCCTCCCCCTGG + Intronic
1034147157 7:148883896-148883918 GCCCCCCGCCCCGCAGCTCCAGG + Intronic
1034273790 7:149815427-149815449 GGCCCCTGTGCCGCTGCCCCGGG + Intergenic
1034345655 7:150383878-150383900 GTCCTCCCCATCGCCGCCCCTGG - Intronic
1034355912 7:150450759-150450781 GGCCCCGGCGCCCCAGCCCCTGG + Exonic
1034560626 7:151877329-151877351 CCCCGCCGCGCCGCGGCCCCAGG + Intergenic
1034618157 7:152436212-152436234 GACCCCCTCGCCGCCCCCGCCGG - Intergenic
1034938148 7:155212836-155212858 GTCCCCCTCTCCGGCTCCCCTGG - Intergenic
1036032708 8:4991673-4991695 GGGCCCAGCGCCGACGCCCCCGG + Intronic
1036801395 8:11795037-11795059 CTCCCCCGCGCCGCCGCCGTGGG + Intergenic
1037826778 8:22164791-22164813 CTGCCCCGCGCCCCCGCCTCGGG - Exonic
1038828513 8:31033033-31033055 GTCCCGCGCTCCGCGGCCCCAGG + Exonic
1039454616 8:37698459-37698481 CTCCCCCCGCCCGCCGCCCCCGG + Exonic
1040981603 8:53251137-53251159 GTCCCCAGCGCCGCTGGCCAGGG - Intronic
1041166924 8:55101174-55101196 GCGCCCCGCGCCGCCGCCAGGGG + Intergenic
1041690053 8:60679277-60679299 GTCGCCGGCGTCGCCGCCCGCGG + Intronic
1042040080 8:64580922-64580944 GTCCCTGGCGCCGCCGCCTCGGG + Exonic
1042215910 8:66429545-66429567 AGCCCCAGCGCCGCCGCCACTGG - Exonic
1044569391 8:93700519-93700541 GCCCCTCGCGCCGCCGCGGCAGG - Exonic
1044719753 8:95134000-95134022 GTCGCCGCCGCCGCCGCCCGCGG + Exonic
1045488596 8:102654078-102654100 CTCGCCCACGCCCCCGCCCCGGG - Intronic
1049354103 8:142179255-142179277 GACCCCCGAGCCTCCGGCCCCGG + Intergenic
1049621070 8:143598560-143598582 CGCCCCGGCCCCGCCGCCCCCGG + Exonic
1049689974 8:143954069-143954091 CTCCCCAGCTCCGCAGCCCCCGG + Intronic
1049762201 8:144336655-144336677 GGGCCCGGCGCCGCCGCCCCCGG - Intergenic
1049844289 8:144792541-144792563 GGCCCCCGCGCAGGCGCACCAGG + Exonic
1049896240 9:113908-113930 GGCCTCTGCGCCGCCGCCCCCGG - Intergenic
1049932429 9:470118-470140 CTGCCCTTCGCCGCCGCCCCCGG - Intergenic
1051414868 9:16828948-16828970 CTCCCCCGCGCCCCAGCCTCTGG - Intronic
1051626247 9:19102492-19102514 CTCCCTCGCCCCGCCGGCCCCGG + Intronic
1053381178 9:37650798-37650820 GCCCCGCGCGCCGCCTCCGCTGG - Intronic
1053434847 9:38068052-38068074 GTCCCCGGCCCCACCGCCCGCGG + Exonic
1053434987 9:38068658-38068680 GGCTCCCGCGCCGCGGCCCTAGG - Exonic
1053835343 9:42129335-42129357 GGGCCGCGCGGCGCCGCCCCAGG + Exonic
1054091012 9:60847298-60847320 GGGCCGCGCGGCGCCGCCCCAGG + Intergenic
1054112423 9:61122854-61122876 GGGCCGCGCGGCGCCGCCCCAGG + Intergenic
1054595282 9:67059275-67059297 GGGCCGCGCGGCGCCGCCCCAGG - Intergenic
1058058586 9:100473359-100473381 GTCCCGAGCGCCGCGGGCCCGGG + Exonic
1059145672 9:111897112-111897134 GCCTCCCGCGCCCCCGCACCGGG + Exonic
1059414757 9:114155862-114155884 GCCCCCCGCCCCGCCGCGCCAGG - Exonic
1059769924 9:117415124-117415146 CCCCCCCGCGCCGCCTCCCGGGG + Intergenic
1060209099 9:121699481-121699503 GTCCCCCGCGCCGCCGCCCCGGG + Intronic
1060283477 9:122228850-122228872 GGCGCCGGCCCCGCCGCCCCGGG + Intronic
1060477942 9:123999675-123999697 GCCGCCCCCGCCCCCGCCCCCGG + Intergenic
1060555277 9:124504736-124504758 CTCGGCCGCGCCGCCGCCGCCGG + Intronic
1060713078 9:125889931-125889953 GTCCCCCGCGCCGGCGGCCCCGG + Intronic
1060733061 9:126050015-126050037 GTCCCCCCCACCCCCGTCCCAGG - Intergenic
1060738354 9:126080889-126080911 GTCCCCAGTGCTGCCTCCCCAGG + Intergenic
1060945742 9:127568715-127568737 CTCCCCCGAGCCCCCGGCCCCGG + Intronic
1061693454 9:132354254-132354276 ATCCTCCGAGCCGCCGCGCCCGG - Intronic
1061920955 9:133782096-133782118 CTCCCCCGCCCCGCCCCCGCCGG - Intronic
1061929518 9:133825191-133825213 GTCCCCCGCCCCCCCACCCCAGG - Intronic
1062022617 9:134326552-134326574 GCCCCCGGCGCGGCCGGCCCGGG - Intronic
1062412529 9:136432225-136432247 GCCCGCCCCGCCGCCTCCCCTGG - Intronic
1062499669 9:136846979-136847001 CAGCCCCGCGCGGCCGCCCCCGG + Exonic
1062558859 9:137130175-137130197 GGCCCCCGCGACGCCGCGCCCGG - Intergenic
1203466897 Un_GL000220v1:96268-96290 GCCCCCCGCCCCGGAGCCCCAGG + Intergenic
1203586673 Un_KI270747v1:9952-9974 GCCCCCCCCCCCGCCGCCTCGGG - Intergenic
1185506434 X:634835-634857 GGGCCCCCCGCCCCCGCCCCCGG - Intronic
1186463349 X:9765622-9765644 GTCCCCCGCGACGTCCCCGCCGG - Exonic
1187257525 X:17656166-17656188 GGGCCCCGCGCCGGCTCCCCGGG - Intronic
1187900940 X:24025859-24025881 TTCCCCCGCGGCGCCGCCGTCGG + Intronic
1190285303 X:48957468-48957490 CTCCGCCGCGCCGCGGCGCCGGG + Exonic
1190385599 X:49879883-49879905 GTGCGCCGCGCCGCCGACCCCGG + Intergenic
1190881493 X:54495480-54495502 TCCGCCCGCGCCTCCGCCCCAGG - Exonic
1192533715 X:71911060-71911082 GTCCCCTGCGCCCGCGCCCGCGG + Intergenic
1194666821 X:96685068-96685090 GCTCCCGACGCCGCCGCCCCGGG - Exonic
1196196349 X:112841421-112841443 TTCCTCCGCTCCCCCGCCCCGGG + Intergenic
1197709345 X:129654654-129654676 CTCCCCCGCGCCGGCTCGCCGGG - Exonic
1198254687 X:134914826-134914848 GTCCCGCGAGCCGCATCCCCGGG + Intronic
1198750342 X:139932278-139932300 ATCCGCGGGGCCGCCGCCCCCGG - Intronic
1198807001 X:140503165-140503187 GTCTCCCGCCTCGCCGCCCCTGG - Exonic
1200239573 X:154486634-154486656 CCGCCGCGCGCCGCCGCCCCGGG + Exonic