ID: 1060209165

View in Genome Browser
Species Human (GRCh38)
Location 9:121699645-121699667
Sequence ACTCACCTAACCCCGGAGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 144
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 137}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1060209165_1060209179 25 Left 1060209165 9:121699645-121699667 CCTCCCTCCGGGGTTAGGTGAGT 0: 1
1: 0
2: 0
3: 6
4: 137
Right 1060209179 9:121699693-121699715 CGCGGCGGCCCGGGCGAGGCCGG No data
1060209165_1060209173 10 Left 1060209165 9:121699645-121699667 CCTCCCTCCGGGGTTAGGTGAGT 0: 1
1: 0
2: 0
3: 6
4: 137
Right 1060209173 9:121699678-121699700 AGAGCAGAGGGTGCCCGCGGCGG No data
1060209165_1060209175 16 Left 1060209165 9:121699645-121699667 CCTCCCTCCGGGGTTAGGTGAGT 0: 1
1: 0
2: 0
3: 6
4: 137
Right 1060209175 9:121699684-121699706 GAGGGTGCCCGCGGCGGCCCGGG No data
1060209165_1060209180 26 Left 1060209165 9:121699645-121699667 CCTCCCTCCGGGGTTAGGTGAGT 0: 1
1: 0
2: 0
3: 6
4: 137
Right 1060209180 9:121699694-121699716 GCGGCGGCCCGGGCGAGGCCGGG No data
1060209165_1060209176 21 Left 1060209165 9:121699645-121699667 CCTCCCTCCGGGGTTAGGTGAGT 0: 1
1: 0
2: 0
3: 6
4: 137
Right 1060209176 9:121699689-121699711 TGCCCGCGGCGGCCCGGGCGAGG No data
1060209165_1060209174 15 Left 1060209165 9:121699645-121699667 CCTCCCTCCGGGGTTAGGTGAGT 0: 1
1: 0
2: 0
3: 6
4: 137
Right 1060209174 9:121699683-121699705 AGAGGGTGCCCGCGGCGGCCCGG No data
1060209165_1060209170 -3 Left 1060209165 9:121699645-121699667 CCTCCCTCCGGGGTTAGGTGAGT 0: 1
1: 0
2: 0
3: 6
4: 137
Right 1060209170 9:121699665-121699687 AGTAGAAGAGAGGAGAGCAGAGG No data
1060209165_1060209171 -2 Left 1060209165 9:121699645-121699667 CCTCCCTCCGGGGTTAGGTGAGT 0: 1
1: 0
2: 0
3: 6
4: 137
Right 1060209171 9:121699666-121699688 GTAGAAGAGAGGAGAGCAGAGGG No data
1060209165_1060209172 7 Left 1060209165 9:121699645-121699667 CCTCCCTCCGGGGTTAGGTGAGT 0: 1
1: 0
2: 0
3: 6
4: 137
Right 1060209172 9:121699675-121699697 AGGAGAGCAGAGGGTGCCCGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1060209165 Original CRISPR ACTCACCTAACCCCGGAGGG AGG (reversed) Intronic
900549009 1:3244380-3244402 ACTCTCCTAACTCCCGAGAGTGG + Intronic
901489718 1:9590378-9590400 TCTCAGCTAACCCAGGATGGGGG + Intronic
902641905 1:17772334-17772356 GCTCACCTCACCCCAGAAGGTGG + Intronic
902958728 1:19945927-19945949 ACTCACCTAACCCAGATGGGTGG - Intergenic
907501464 1:54884690-54884712 ACTCCCCTACCCCAGGAGGTGGG + Intronic
908194221 1:61733280-61733302 AATCACTTAAACTCGGAGGGCGG - Intergenic
909588838 1:77322425-77322447 ACTCAGCAACCCCCAGAGGGAGG - Intronic
910788666 1:91028145-91028167 ACTCACTTGAACCCGGAAGGTGG + Intergenic
912790434 1:112644275-112644297 AATCACCTCAACCCGGAAGGTGG - Intronic
915039342 1:152954778-152954800 ACACACCTGGCCCCGGAAGGTGG - Intergenic
915498101 1:156295231-156295253 ACTCCCCTGACCCTGGTGGGCGG + Intronic
922686627 1:227643948-227643970 AATCACTTGAACCCGGAGGGCGG - Intronic
922950829 1:229557992-229558014 CCACTCCTAACCCCGGAGGAGGG - Intronic
1063472488 10:6299359-6299381 AGTCAGCTGACCCAGGAGGGTGG + Intergenic
1063731080 10:8697916-8697938 AATCACTTAACCCCGGGAGGCGG - Intergenic
1067392702 10:45879146-45879168 ACTCACTTGAACCTGGAGGGTGG + Intergenic
1067861028 10:49848260-49848282 ACTCACTTGAACCTGGAGGGTGG + Intronic
1070119642 10:73563522-73563544 AATCACTTGAACCCGGAGGGTGG - Intronic
1073076364 10:100827679-100827701 TCTGACCCCACCCCGGAGGGAGG + Exonic
1074264304 10:111886102-111886124 ATTCACCTATCCCTGGAGGAGGG + Intergenic
1077022285 11:422914-422936 AATCACTTAAACCCGGAAGGTGG - Intronic
1077100924 11:822007-822029 ACTCACCACCCCCTGGAGGGAGG - Exonic
1078233996 11:9467320-9467342 AATCACTTGAACCCGGAGGGTGG - Intronic
1081867852 11:46369435-46369457 ACATACCTGACCCCGAAGGGAGG + Intronic
1086801609 11:91183628-91183650 ACTCTCCAAATCCCAGAGGGTGG + Intergenic
1088239871 11:107762216-107762238 AATCACTTAAACCCGGGGGGTGG + Intergenic
1090670209 11:128940674-128940696 TCTCACACAACCCCGGAGAGTGG - Intronic
1096156335 12:49343257-49343279 AATCACCTAACCCCAGAAGAGGG - Intergenic
1096664772 12:53156409-53156431 ACTCACTTGAACCCGGAAGGCGG + Intergenic
1101091797 12:101294627-101294649 AATCACTTGAACCCGGAGGGTGG - Intronic
1103006505 12:117424858-117424880 AATCACCTAAACCCGGGAGGCGG + Intronic
1103623027 12:122200417-122200439 ACTCATCTAACCAGGGAGTGCGG - Intronic
1104462695 12:128968574-128968596 AATCACTTGAACCCGGAGGGTGG + Intronic
1104564711 12:129870386-129870408 ACTCCCCAAACCCCTGAGGAAGG + Intronic
1110212298 13:72987947-72987969 AATCACATAAACCCGGGGGGCGG - Intronic
1115270608 14:31548137-31548159 ACTCACCTGAACCCGGGAGGCGG - Intronic
1115591222 14:34867170-34867192 AATCACCTGAACCCGGAAGGTGG + Intronic
1118229257 14:63932293-63932315 AATCACTTAAACCCGGAAGGCGG + Intronic
1124342965 15:28901775-28901797 ACGTCCCTAACCCCGCAGGGTGG - Intronic
1125185485 15:36924929-36924951 ACTCACCTACTCCAGAAGGGAGG - Intronic
1125633491 15:41167822-41167844 GATCACTTAACCCCAGAGGGTGG + Intergenic
1126084514 15:44999268-44999290 ACTTCCCCAACCCCAGAGGGAGG - Intergenic
1126614232 15:50559924-50559946 AATCACTTAAACCCGGAAGGCGG + Exonic
1126688049 15:51265459-51265481 AGTCTCCTCAGCCCGGAGGGAGG + Intronic
1128020784 15:64388391-64388413 AATCACCTGAACCCGGAAGGCGG - Intronic
1133950536 16:10387987-10388009 AATCACTTGAACCCGGAGGGAGG - Intronic
1135138243 16:19900504-19900526 AATCACCTGAACCCGGAAGGCGG + Intergenic
1138235932 16:55382637-55382659 ACTTACCTTACCCTGGAGGTTGG + Intergenic
1138645130 16:58419104-58419126 ACTCACTTAAACCCGGGAGGTGG + Intergenic
1139135470 16:64199007-64199029 AATCACCTGAACCCGGAAGGTGG - Intergenic
1140182987 16:72738916-72738938 AATCACTTAACCCCGAAAGGTGG - Intergenic
1143504290 17:7355413-7355435 ACCCCCCTACCCCCAGAGGGTGG + Intronic
1143526369 17:7475252-7475274 AATCACCTGAACCCGGAAGGCGG + Intronic
1144737605 17:17563836-17563858 ACCCACCTCACCCAGGAGTGGGG + Intronic
1147907128 17:43830698-43830720 ACTCACCTAACCCCAGGAGATGG - Intronic
1151308290 17:73278054-73278076 ACTCACCTAAGCCTGGGAGGTGG - Intergenic
1152500932 17:80708593-80708615 ACCCACCACACCCTGGAGGGTGG - Intronic
1152500951 17:80708666-80708688 ACCCACCACACCCTGGAGGGTGG - Intronic
1152863984 17:82711416-82711438 AATCACCTGAACCCGGAAGGTGG - Intergenic
1152997415 18:420789-420811 AATTACCTAGCCCTGGAGGGAGG - Intronic
1159214674 18:65375269-65375291 ACTCACCCAACCCCACAGGATGG - Intergenic
1165082160 19:33313979-33314001 AATCACTTGAACCCGGAGGGTGG + Intergenic
1166076107 19:40414694-40414716 ACTCACCAGACCCCGGGGGGCGG + Intergenic
1166224918 19:41389030-41389052 AATCACTTAAACCTGGAGGGTGG - Intronic
1167092561 19:47354735-47354757 AATCACCTAAACCCGGGAGGCGG - Intronic
1167664441 19:50815728-50815750 ACTCACATAACCCTGGATGAGGG - Intergenic
925688309 2:6495014-6495036 ACTCACTTGAACCCGGGGGGTGG + Intergenic
932786331 2:74607558-74607580 AATCACTTGACCCCGGAAGGCGG - Intronic
933751719 2:85606866-85606888 AATCACCTAAACCTGGAAGGCGG - Exonic
934540963 2:95174654-95174676 GCTCACCTAACCCAGCAGGGAGG - Intronic
939922912 2:148139291-148139313 AATCACCTGAACCCGGAAGGTGG - Intronic
940205126 2:151193994-151194016 ACCCACCTAACCCAGGAGTAGGG + Intergenic
941979252 2:171436859-171436881 AATCACCTGAACCCGGAAGGTGG - Intronic
942073444 2:172335814-172335836 CAGCACCTAACCCAGGAGGGTGG - Intergenic
944851598 2:203725201-203725223 AATCACCTGAACCCAGAGGGCGG + Intronic
949077061 2:242066985-242067007 AATCACCTGAACCCGGAAGGCGG - Intergenic
1168828229 20:828667-828689 AATCACCTAAACCCGGGAGGCGG - Intergenic
1172335542 20:34112541-34112563 ACTACCCTAACCCAGGAGGAAGG - Intergenic
1172691995 20:36796543-36796565 ACTCTCCTAACTCCAGAGGCAGG + Intronic
1173799152 20:45883922-45883944 ACTCACCTCACCGAGGAGGTGGG + Exonic
1174355913 20:49997903-49997925 ACTCACCAAACCCTGCAGGAGGG + Intergenic
1177754084 21:25323204-25323226 AATCACTTGAACCCGGAGGGTGG + Intergenic
1179401507 21:41088495-41088517 AGTCACTTGAACCCGGAGGGCGG + Intergenic
1182432434 22:30307879-30307901 AATCACTTAAACCCGGAAGGCGG - Intronic
1182542553 22:31052201-31052223 AATCACCTAAACCCGGGAGGTGG + Intergenic
1185114830 22:48926695-48926717 ACTCTCCTAACTCCCGAGGCTGG + Intergenic
953695318 3:45153652-45153674 AATCACCTAAACCCGGGAGGTGG + Intergenic
954265949 3:49470417-49470439 ACTCACCCAGCGCCGGCGGGAGG - Exonic
955146141 3:56322079-56322101 AATCACCTAACCACAGAGCGTGG + Intronic
955156827 3:56425232-56425254 ACTCACCAAGTCCTGGAGGGAGG + Intronic
964474669 3:157088000-157088022 ACTCACCATACCCAAGAGGGAGG - Intergenic
966202121 3:177368310-177368332 AATCACATAAACCCGGAAGGCGG - Intergenic
966456927 3:180128057-180128079 ACTCACTTGAACCCGGAAGGTGG + Intergenic
967872539 3:194243975-194243997 AATCACCTGAACCCGGGGGGTGG + Intergenic
968884546 4:3320702-3320724 ACTCACCTAACTACACAGGGAGG - Intronic
969224044 4:5782822-5782844 ACTCACTTAAGCATGGAGGGTGG + Intronic
973964215 4:56144740-56144762 AATCACCTGAACCCGGAAGGCGG - Intergenic
979251697 4:118572865-118572887 ACTCACCTAAGCCAGGGGCGGGG + Intergenic
979538888 4:121856854-121856876 AATCACTTAAACCCGGAAGGTGG - Intronic
980935209 4:139219611-139219633 ACTCACTTGAACCCGGGGGGTGG + Intergenic
982712176 4:158768865-158768887 GCTCACGTAACCCCGGCGGGAGG - Intergenic
983611713 4:169653552-169653574 AATCACTTGAACCCGGAGGGTGG + Intronic
984636935 4:182121083-182121105 AATCACTTGAACCCGGAGGGCGG - Intergenic
988139441 5:27217589-27217611 ACTCACCTAAGTCTGCAGGGTGG - Intergenic
988518148 5:31922763-31922785 AGTCACTTGAGCCCGGAGGGGGG - Intronic
992418594 5:76578397-76578419 AATCACCTGAACCCGGAAGGTGG - Intronic
996703211 5:126470643-126470665 ACTCACTTAAACCCGGGAGGTGG - Intronic
996740428 5:126793787-126793809 AATCACTTAAACCCGGAAGGCGG + Intronic
999758904 5:154685155-154685177 AATCACTTGAACCCGGAGGGTGG + Intergenic
1004692751 6:18006471-18006493 AATCACCTGAACCCGGGGGGTGG + Intergenic
1008686942 6:53935444-53935466 AATCACCTGAACCCGGGGGGTGG + Intronic
1010867623 6:80999087-80999109 ACTCACTTGAACCCGGAAGGTGG - Intergenic
1019774189 7:2902534-2902556 TCTCACCCAACCCAGGAAGGGGG - Intergenic
1020831506 7:13101567-13101589 ACTCACCTATTCCCAGAGGCAGG - Intergenic
1022731074 7:33026439-33026461 AATCACTTAACCCCGGGAGGCGG - Intronic
1029378376 7:100196365-100196387 AATCGCCTAAACCCGGGGGGTGG - Intronic
1031516455 7:122705017-122705039 ACTCTCCCAACCCCGATGGGTGG + Intronic
1032145353 7:129374718-129374740 AATCACTTGAACCCGGAGGGTGG + Intronic
1032363239 7:131275453-131275475 AATCACCTGAACCCGGAAGGTGG - Intronic
1032992204 7:137406053-137406075 TCTCACCTAACTCCAGAGAGAGG + Intronic
1033790624 7:144788855-144788877 AATCGCTTAAACCCGGAGGGTGG + Intronic
1035145497 7:156811520-156811542 AATCACCTAAACCCGGGAGGCGG + Intronic
1035530341 8:345992-346014 GCTCACCTGACCATGGAGGGTGG - Intergenic
1035535612 8:388869-388891 AATCACCTGAACCCGGAAGGCGG - Intergenic
1035870250 8:3129892-3129914 AATCACCTGAGCCCGGGGGGCGG + Intronic
1039605294 8:38875531-38875553 AATCACCTGAACCCGGAAGGTGG - Intergenic
1041026196 8:53689249-53689271 ACTCACTTCACCCAGGAGAGAGG - Intergenic
1043074996 8:75687343-75687365 AATCACTTAAGCCCGGAAGGAGG - Intergenic
1044968633 8:97598261-97598283 ACTGCCCTAACCCCGCAGCGCGG + Intergenic
1046331510 8:112721487-112721509 AATCACCTGAACCCGGAAGGCGG + Intronic
1047737293 8:127777248-127777270 AATCACTTAAACCCGGTGGGTGG - Intergenic
1049727951 8:144159269-144159291 AATCACTTAAACCCGGAAGGCGG + Intronic
1050042504 9:1510904-1510926 ACTCACCTAGCCCAGCAGGTAGG + Intergenic
1051635402 9:19176854-19176876 AATCACTTAAACCCGGGGGGTGG + Intergenic
1052354951 9:27494599-27494621 AATCACTTAAACCCAGAGGGCGG - Intronic
1054762078 9:69012892-69012914 GCTCCCCCAACCCTGGAGGGTGG + Exonic
1058695079 9:107552044-107552066 ACTCACCTGAACCCGGGAGGCGG + Intergenic
1060209165 9:121699645-121699667 ACTCACCTAACCCCGGAGGGAGG - Intronic
1061284902 9:129616647-129616669 ACTCACCAAACCCAGGAGGATGG - Intronic
1187425831 X:19176497-19176519 ACTCACCTACCACTGGAGGGAGG + Intergenic
1189309517 X:40009663-40009685 ACGCACCGAACCCGGGAGTGCGG - Intergenic
1190009760 X:46774491-46774513 AATCACTTGAACCCGGAGGGCGG - Intergenic
1191997769 X:67114927-67114949 AATCACCTGAACCTGGAGGGCGG - Intergenic
1192844990 X:74897305-74897327 ACTCTCCTAACCCATGTGGGAGG - Intronic