ID: 1060210103

View in Genome Browser
Species Human (GRCh38)
Location 9:121704940-121704962
Sequence GAGCCCCATGGGCACCTTTG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1060210097_1060210103 2 Left 1060210097 9:121704915-121704937 CCCTCTCAACTGCAGCATTGTAC 0: 1
1: 0
2: 0
3: 15
4: 194
Right 1060210103 9:121704940-121704962 GAGCCCCATGGGCACCTTTGGGG No data
1060210098_1060210103 1 Left 1060210098 9:121704916-121704938 CCTCTCAACTGCAGCATTGTACT 0: 1
1: 0
2: 0
3: 16
4: 155
Right 1060210103 9:121704940-121704962 GAGCCCCATGGGCACCTTTGGGG No data
1060210096_1060210103 3 Left 1060210096 9:121704914-121704936 CCCCTCTCAACTGCAGCATTGTA 0: 1
1: 0
2: 2
3: 14
4: 157
Right 1060210103 9:121704940-121704962 GAGCCCCATGGGCACCTTTGGGG No data
1060210095_1060210103 9 Left 1060210095 9:121704908-121704930 CCAGATCCCCTCTCAACTGCAGC 0: 1
1: 1
2: 0
3: 21
4: 210
Right 1060210103 9:121704940-121704962 GAGCCCCATGGGCACCTTTGGGG No data
1060210094_1060210103 22 Left 1060210094 9:121704895-121704917 CCAGGCATTGGAACCAGATCCCC 0: 1
1: 0
2: 0
3: 9
4: 131
Right 1060210103 9:121704940-121704962 GAGCCCCATGGGCACCTTTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1060210103 Original CRISPR GAGCCCCATGGGCACCTTTG GGG Intronic
No off target data available for this crispr