ID: 1060210201

View in Genome Browser
Species Human (GRCh38)
Location 9:121705764-121705786
Sequence CCAGGCCTGACAGGTGCCAT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1060210195_1060210201 -10 Left 1060210195 9:121705751-121705773 CCAGGCCCAGGTGCCAGGCCTGA 0: 1
1: 0
2: 5
3: 69
4: 494
Right 1060210201 9:121705764-121705786 CCAGGCCTGACAGGTGCCATGGG No data
1060210184_1060210201 23 Left 1060210184 9:121705718-121705740 CCTCCCCTCTCACCTTCGGTTAC 0: 1
1: 0
2: 0
3: 19
4: 177
Right 1060210201 9:121705764-121705786 CCAGGCCTGACAGGTGCCATGGG No data
1060210185_1060210201 20 Left 1060210185 9:121705721-121705743 CCCCTCTCACCTTCGGTTACCAG 0: 1
1: 0
2: 0
3: 6
4: 107
Right 1060210201 9:121705764-121705786 CCAGGCCTGACAGGTGCCATGGG No data
1060210188_1060210201 18 Left 1060210188 9:121705723-121705745 CCTCTCACCTTCGGTTACCAGGC 0: 1
1: 0
2: 1
3: 7
4: 72
Right 1060210201 9:121705764-121705786 CCAGGCCTGACAGGTGCCATGGG No data
1060210194_1060210201 -9 Left 1060210194 9:121705750-121705772 CCCAGGCCCAGGTGCCAGGCCTG 0: 1
1: 0
2: 8
3: 76
4: 613
Right 1060210201 9:121705764-121705786 CCAGGCCTGACAGGTGCCATGGG No data
1060210189_1060210201 11 Left 1060210189 9:121705730-121705752 CCTTCGGTTACCAGGCAGAGCCC 0: 1
1: 0
2: 0
3: 7
4: 155
Right 1060210201 9:121705764-121705786 CCAGGCCTGACAGGTGCCATGGG No data
1060210192_1060210201 1 Left 1060210192 9:121705740-121705762 CCAGGCAGAGCCCAGGCCCAGGT 0: 1
1: 1
2: 9
3: 72
4: 584
Right 1060210201 9:121705764-121705786 CCAGGCCTGACAGGTGCCATGGG No data
1060210186_1060210201 19 Left 1060210186 9:121705722-121705744 CCCTCTCACCTTCGGTTACCAGG 0: 1
1: 0
2: 1
3: 7
4: 84
Right 1060210201 9:121705764-121705786 CCAGGCCTGACAGGTGCCATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1060210201 Original CRISPR CCAGGCCTGACAGGTGCCAT GGG Intronic
No off target data available for this crispr