ID: 1060211345

View in Genome Browser
Species Human (GRCh38)
Location 9:121712383-121712405
Sequence GGGAGCAATGCTTATGCAGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1060211340_1060211345 -2 Left 1060211340 9:121712362-121712384 CCTCTTTTCTGGCAGCCCAAAGG 0: 1
1: 0
2: 1
3: 20
4: 161
Right 1060211345 9:121712383-121712405 GGGAGCAATGCTTATGCAGCAGG No data
1060211339_1060211345 -1 Left 1060211339 9:121712361-121712383 CCCTCTTTTCTGGCAGCCCAAAG 0: 1
1: 0
2: 1
3: 20
4: 262
Right 1060211345 9:121712383-121712405 GGGAGCAATGCTTATGCAGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1060211345 Original CRISPR GGGAGCAATGCTTATGCAGC AGG Intronic
No off target data available for this crispr