ID: 1060212355

View in Genome Browser
Species Human (GRCh38)
Location 9:121718291-121718313
Sequence GCGTTCAGGCAGATGGTGCA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1060212350_1060212355 24 Left 1060212350 9:121718244-121718266 CCAAGGCTCACTCACTCACTCAC 0: 1
1: 2
2: 25
3: 172
4: 910
Right 1060212355 9:121718291-121718313 GCGTTCAGGCAGATGGTGCAAGG No data
1060212349_1060212355 27 Left 1060212349 9:121718241-121718263 CCTCCAAGGCTCACTCACTCACT 0: 1
1: 0
2: 5
3: 27
4: 300
Right 1060212355 9:121718291-121718313 GCGTTCAGGCAGATGGTGCAAGG No data
1060212348_1060212355 28 Left 1060212348 9:121718240-121718262 CCCTCCAAGGCTCACTCACTCAC 0: 1
1: 0
2: 1
3: 30
4: 277
Right 1060212355 9:121718291-121718313 GCGTTCAGGCAGATGGTGCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1060212355 Original CRISPR GCGTTCAGGCAGATGGTGCA AGG Intronic
No off target data available for this crispr