ID: 1060212613

View in Genome Browser
Species Human (GRCh38)
Location 9:121719809-121719831
Sequence GTTGCTGGTGGTTCACATTT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 185
Summary {0: 1, 1: 0, 2: 1, 3: 19, 4: 164}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1060212613_1060212623 22 Left 1060212613 9:121719809-121719831 CCAAAATGTGAACCACCAGCAAC 0: 1
1: 0
2: 1
3: 19
4: 164
Right 1060212623 9:121719854-121719876 GCCACCACCTGTTTGGGATGGGG No data
1060212613_1060212619 15 Left 1060212613 9:121719809-121719831 CCAAAATGTGAACCACCAGCAAC 0: 1
1: 0
2: 1
3: 19
4: 164
Right 1060212619 9:121719847-121719869 TCTGGTGGCCACCACCTGTTTGG No data
1060212613_1060212621 20 Left 1060212613 9:121719809-121719831 CCAAAATGTGAACCACCAGCAAC 0: 1
1: 0
2: 1
3: 19
4: 164
Right 1060212621 9:121719852-121719874 TGGCCACCACCTGTTTGGGATGG No data
1060212613_1060212620 16 Left 1060212613 9:121719809-121719831 CCAAAATGTGAACCACCAGCAAC 0: 1
1: 0
2: 1
3: 19
4: 164
Right 1060212620 9:121719848-121719870 CTGGTGGCCACCACCTGTTTGGG No data
1060212613_1060212616 -3 Left 1060212613 9:121719809-121719831 CCAAAATGTGAACCACCAGCAAC 0: 1
1: 0
2: 1
3: 19
4: 164
Right 1060212616 9:121719829-121719851 AACATGACTCTCAAGTCCTCTGG No data
1060212613_1060212622 21 Left 1060212613 9:121719809-121719831 CCAAAATGTGAACCACCAGCAAC 0: 1
1: 0
2: 1
3: 19
4: 164
Right 1060212622 9:121719853-121719875 GGCCACCACCTGTTTGGGATGGG No data
1060212613_1060212617 0 Left 1060212613 9:121719809-121719831 CCAAAATGTGAACCACCAGCAAC 0: 1
1: 0
2: 1
3: 19
4: 164
Right 1060212617 9:121719832-121719854 ATGACTCTCAAGTCCTCTGGTGG No data
1060212613_1060212625 25 Left 1060212613 9:121719809-121719831 CCAAAATGTGAACCACCAGCAAC 0: 1
1: 0
2: 1
3: 19
4: 164
Right 1060212625 9:121719857-121719879 ACCACCTGTTTGGGATGGGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1060212613 Original CRISPR GTTGCTGGTGGTTCACATTT TGG (reversed) Intronic
902952455 1:19896963-19896985 GTTGTTGATGTTTCTCATTTAGG + Intronic
903510436 1:23870623-23870645 GTCCCTGCAGGTTCACATTTTGG - Exonic
906098988 1:43244228-43244250 TTTTCTGGTGGTTTACATTAAGG + Intronic
907561664 1:55396220-55396242 GTTGCTAGTGGTTATCATTTTGG + Intergenic
911002964 1:93185940-93185962 TTTGTTGGTGGTGGACATTTGGG + Intronic
911903340 1:103532366-103532388 GCTCCTGGTGGAGCACATTTGGG + Intronic
912115269 1:106398955-106398977 GATGCTGGTAATACACATTTTGG - Intergenic
916624595 1:166541473-166541495 GATTTTGGGGGTTCACATTTTGG - Intergenic
917907869 1:179606107-179606129 GTTGCTAGTGTTTTAGATTTTGG + Intronic
921967574 1:221106851-221106873 GTTGCTGTTGTTTCTCTTTTGGG - Intergenic
922867939 1:228876367-228876389 GTTGCTGGGGGATCCCACTTGGG + Intergenic
1065259083 10:23906034-23906056 GTTGCTGGTTCCTCACATGTTGG + Intronic
1067335250 10:45356461-45356483 ATTGCTGGAGGTTAACAGTTGGG + Intergenic
1067903454 10:50265940-50265962 GTTGTTGGTGGTACATATTCAGG + Intergenic
1068710812 10:60131827-60131849 GGTGGTGGTGGTTCCAATTTCGG + Intronic
1074649728 10:115506859-115506881 GATTTTGGGGGTTCACATTTTGG - Intronic
1074822444 10:117190956-117190978 GTTGCTAGTGTTTTGCATTTTGG - Intergenic
1079009096 11:16813680-16813702 GTTGCTGGTGGTTATCATTCTGG - Intronic
1080325548 11:31068437-31068459 TTTCCTGGTGATGCACATTTAGG - Intronic
1082059255 11:47846632-47846654 GTTGCTGGTGGCTCAATTGTGGG - Intronic
1082773101 11:57224044-57224066 GATGTTGGTGGGTCACATTAGGG - Intergenic
1086787171 11:90983247-90983269 GTTGCTTGTGCTTCACAGTTGGG + Intergenic
1088445192 11:109918938-109918960 GTTGTTGGTGTTTCAAATTTTGG + Intergenic
1089978609 11:122754087-122754109 GTGGCTAGTGGTTAGCATTTTGG + Intronic
1090049149 11:123362141-123362163 GTTGCTGGTGATCCACAGTAGGG + Intergenic
1094298467 12:28934740-28934762 GTTGCTTGTGTCTCAAATTTGGG + Intergenic
1094441372 12:30480779-30480801 GTTTCTGGTGGCTAACTTTTTGG - Intergenic
1095082704 12:38025868-38025890 GTTGCTTTTGGTTCACAGTTTGG + Intergenic
1095647852 12:44570279-44570301 GATGCTGGTGCTCCACAATTAGG + Intronic
1096608931 12:52788449-52788471 GGAGCTGTTGCTTCACATTTGGG - Intergenic
1096997167 12:55845863-55845885 GTTACTAGTGGTTCTCTTTTGGG - Intergenic
1097524196 12:60710185-60710207 GTTGATGGTGCTTTGCATTTTGG - Intergenic
1097900835 12:64872468-64872490 GTTGATGGTGGTTCTCTTTAAGG + Intronic
1098141489 12:67454271-67454293 GATGATGGTGGTTTACTTTTTGG - Intergenic
1098689890 12:73473509-73473531 GCTGCAAGTGGTGCACATTTGGG + Intergenic
1099217899 12:79875876-79875898 GTTCCTGTTTGTTCATATTTGGG + Intronic
1101829712 12:108248067-108248089 GGTGCTGGTGGTGCACTTTGAGG + Exonic
1105892336 13:24690570-24690592 GTTGAAGGTGGTTCACAGCTGGG - Intronic
1106302082 13:28476761-28476783 GTTGCTGGTGTTAAACATTTAGG - Intronic
1107043267 13:35970878-35970900 GAGGCTGGTGATTAACATTTAGG - Intronic
1107344695 13:39446563-39446585 GTTGATTGTGGTACACAGTTGGG - Intronic
1109422454 13:62131494-62131516 GTTATTTGGGGTTCACATTTTGG + Intergenic
1110390835 13:74971922-74971944 GTTTCTGTTCTTTCACATTTGGG - Intergenic
1111192081 13:84822237-84822259 ATTTCAGGTGGTTTACATTTTGG - Intergenic
1111547593 13:89762850-89762872 GTTTCTGGAGGTGTACATTTAGG - Intergenic
1111588538 13:90312670-90312692 GAAGCTGGTGGGGCACATTTGGG + Intergenic
1115373947 14:32652283-32652305 GTGGCTGGTGGCTCCCATTTGGG - Intronic
1115898718 14:38120240-38120262 GTAGATGCTGATTCACATTTAGG - Intergenic
1116735725 14:48688626-48688648 GTTGTTGCAGGTTAACATTTGGG - Intergenic
1117572799 14:57064872-57064894 GGTGCTGCTGGTTCACACTTAGG + Intergenic
1121606180 14:95241879-95241901 GTTGAAGGTGGTTGACATTACGG - Intronic
1124029232 15:25994578-25994600 GTTGATGGTGGCTGTCATTTTGG + Intergenic
1124029238 15:25994632-25994654 TTTGATGGTGGTTGTCATTTTGG + Intergenic
1124362303 15:29046607-29046629 GCTGCAGGTGGTTCTCATGTTGG - Intronic
1127495860 15:59511597-59511619 ATAGCTCCTGGTTCACATTTGGG - Intronic
1128492179 15:68158877-68158899 GTTGCTGGTGGCTACCATATGGG - Intronic
1128642414 15:69349355-69349377 GCTCCTCGTGGGTCACATTTTGG - Intronic
1131158369 15:90088797-90088819 GTTGCTTGGGGTTCAAATTCTGG - Intronic
1131794581 15:96002271-96002293 ATTGCAGGTGGTTAACTTTTGGG - Intergenic
1131810881 15:96171474-96171496 GTTGATGGTGGTTGACAGTGTGG - Intergenic
1133720695 16:8491724-8491746 GTGGCTGGGTGTACACATTTGGG - Intergenic
1137648417 16:50096413-50096435 GTTGCTTTTGGTTGATATTTTGG + Intronic
1141095888 16:81162860-81162882 GGTCCTGGTAGTTCACACTTTGG - Intergenic
1141708180 16:85681251-85681273 GATGCTGGTGGCTCACACTGGGG + Intronic
1144322225 17:14138620-14138642 GTGCCTGGTGGGCCACATTTTGG + Intronic
1148136406 17:45294813-45294835 GTTGCTAGTGGCTACCATTTTGG - Intronic
1153987904 18:10369112-10369134 GTGGCTGGTGGTGCCCATTGGGG + Intergenic
1155780288 18:29823610-29823632 GATTCTGTTGGATCACATTTTGG + Intergenic
1156234481 18:35188442-35188464 GTTGATGGAGGTTCAAATTTGGG - Intergenic
1157243102 18:46029518-46029540 GTTGCTTGTGGTTCTAATTGTGG + Intronic
1158777838 18:60607716-60607738 GTTGCTGGTGGTTATAATGTTGG + Intergenic
1163717817 19:18882248-18882270 GTGGCTGGTGGCTCCCATGTTGG - Intronic
1165240412 19:34462372-34462394 GTTAATGTGGGTTCACATTTTGG - Intronic
1166071733 19:40392184-40392206 GTGGGTGGTGGTTCAGAGTTTGG - Intergenic
1168019970 19:53602053-53602075 GTTGCTGCTGGTGCTCATTGTGG - Exonic
925620437 2:5787072-5787094 GTTCCTTGGGGTTCACAGTTAGG + Intergenic
925913866 2:8590199-8590221 GTTTCTGGTGGTTAACAGTTTGG + Intergenic
928893899 2:36239323-36239345 ATTTCTGGTAGTTGACATTTTGG - Intergenic
936714972 2:115175716-115175738 GTAGCTGGTGGTTATCATATTGG - Intronic
937908988 2:127066294-127066316 GCTGTGGGTGTTTCACATTTTGG - Intronic
938399826 2:130981351-130981373 GTTGCTGTTTGTTCTCCTTTGGG - Intronic
942008009 2:171727866-171727888 GTTGTTGGTGGTACATATTCAGG + Exonic
944562800 2:200958072-200958094 GATGCTGGAGGTTCACTTTGTGG - Exonic
945050514 2:205819843-205819865 GTTGCTTCTTGTTCACATTCTGG + Intergenic
945062372 2:205920433-205920455 GGTGCTAGTGATTCTCATTTGGG - Intergenic
946121817 2:217522868-217522890 GTGGCAGGTGGTTAACATGTAGG - Intronic
946502665 2:220266259-220266281 ATTCCTGGTGGTTCAAATGTTGG + Intergenic
948243388 2:236457197-236457219 GTTGCTAGTGGCTCCCATATTGG - Intronic
1170677563 20:18496770-18496792 TCTGCTGCTGGTTCAGATTTGGG - Intronic
1172375506 20:34436079-34436101 GTTGCTGGGGATTAAAATTTGGG - Intronic
1172977719 20:38919221-38919243 GTGGCTGGTGGCTCAGACTTTGG - Exonic
1173102822 20:40103460-40103482 GTTGCTGGTAGATCAGACTTAGG - Intergenic
1176204667 20:63881775-63881797 GTGGCTGTGGGTTCGCATTTTGG + Intronic
1180176462 21:46092836-46092858 GTGGGTGGTGGTTCACGCTTAGG - Intergenic
1181173538 22:21023410-21023432 GTTGCTGGTGGGTCCCAAGTTGG + Exonic
949965796 3:9355172-9355194 ATTGCTGGTGTTTTAGATTTGGG - Intronic
954788584 3:53113800-53113822 GTGGCTGGTGGCTAACATTTGGG + Intronic
957774490 3:84738357-84738379 GTTCCTGGAGTTTCACATTCAGG - Intergenic
958954335 3:100451111-100451133 GATTTTGGGGGTTCACATTTTGG - Intronic
960268062 3:115644013-115644035 GTTACTGCTGGTTCAGATTAAGG - Intronic
961157067 3:124688959-124688981 GTTGCTGATGGATCACATTGTGG + Intronic
961363968 3:126387790-126387812 TTTGCAGTTGGTTCACATTGGGG + Intergenic
964234081 3:154504905-154504927 GTTGCTGTTGATAGACATTTAGG - Intergenic
966014531 3:175125228-175125250 GTAGCTGGTGGTTAACATACTGG + Intronic
966489023 3:180505679-180505701 ATTTCTGGTGGTTGACATTTAGG - Intergenic
966837934 3:184063900-184063922 GTTACAGGTGTTTCACAGTTTGG + Intergenic
968137779 3:196231519-196231541 GTGCCTGGAAGTTCACATTTGGG - Intronic
971624968 4:28907702-28907724 GTTTCTGGTGGTTAACCTCTGGG - Intergenic
974705077 4:65503955-65503977 GTTACTGATGGTCCACAATTTGG - Intronic
975165379 4:71172761-71172783 GGTGCTGGTGTTTCATATCTAGG - Intergenic
975949157 4:79747183-79747205 GTTGCTGGGCTTTCACACTTAGG + Intergenic
977345895 4:95815296-95815318 GTTGCTGATATTCCACATTTTGG + Intergenic
978752986 4:112273059-112273081 GTTGTTGTTGTTTTACATTTAGG - Intergenic
979884471 4:126008633-126008655 GTTGTTGGTGGTGAATATTTGGG + Intergenic
981184932 4:141789771-141789793 GTTGCTTGTGGTTTTCATTCAGG - Intergenic
982485527 4:155960823-155960845 TTTGCTTCTGGTTCAGATTTCGG + Intergenic
982533294 4:156575421-156575443 ATTCCTGGTGGTAGACATTTGGG - Intergenic
983237990 4:165201411-165201433 GTTCCTGGAGGTAAACATTTTGG + Intronic
986303813 5:6500740-6500762 GTTGCTAGTGGTTCTAATTTGGG - Intergenic
987987274 5:25163318-25163340 GATTTTGGGGGTTCACATTTTGG - Intergenic
988526465 5:31991395-31991417 GGTGCTCGTGGTTCAGATGTGGG + Intronic
994171175 5:96661557-96661579 GTTGCTGCTGGTTCACAATCAGG - Intronic
994844587 5:104971238-104971260 GCTGCTGGTGATTCTTATTTGGG - Intergenic
994883760 5:105530900-105530922 AATGCTGTTGGTTCACATCTGGG - Intergenic
995634606 5:114172185-114172207 GGTGCTGGTAGTTCACTTTGTGG - Intergenic
997612886 5:135227498-135227520 GCTGATGGGGGTTCACATTCTGG + Intronic
998029021 5:138847674-138847696 GTTGCTTGTGGGGCATATTTTGG + Intronic
1000649211 5:163795333-163795355 GTGGCTGGTGGCTACCATTTTGG + Intergenic
1001055253 5:168444154-168444176 GTTACTGATGGTTCACACATTGG + Intronic
1002269962 5:178064839-178064861 CTTGCTGGTGGGTCCCATCTGGG - Intergenic
1003940616 6:11021812-11021834 GGTGCTGCTGGCTCACCTTTTGG + Intronic
1003974784 6:11332026-11332048 GTTGCTTCTGGTTCAAACTTGGG - Intronic
1006653398 6:35569640-35569662 GTTGCTGCTGGTTCACCACTTGG + Intergenic
1007090628 6:39182615-39182637 GGAGCTGGTGGTTAACTTTTTGG - Intergenic
1007974712 6:46089083-46089105 TTTGGTGTTGGTTTACATTTGGG + Intergenic
1008928370 6:56911090-56911112 GTTGCTGGTTCTTGACACTTAGG + Intronic
1011278422 6:85652244-85652266 GTCGCTGTTGGTTCACAATTGGG + Intergenic
1012581262 6:100872925-100872947 GTTTCTGGTTCTTCTCATTTGGG - Intronic
1012963084 6:105643691-105643713 GTTGCTGGTGCTTCAGACCTTGG + Intergenic
1014269128 6:119316107-119316129 GTTGCTGATGCTTCCCATGTTGG - Intronic
1017351597 6:153448997-153449019 GATTTTGGGGGTTCACATTTTGG - Intergenic
1018145482 6:160883382-160883404 GATTTTGGGGGTTCACATTTTGG + Intergenic
1021973618 7:25989502-25989524 TTTGCTGGAGTTTCACCTTTGGG - Intergenic
1022966665 7:35480720-35480742 GCAGCATGTGGTTCACATTTCGG + Intergenic
1023548032 7:41339645-41339667 GTTGCTGATGTTTAAAATTTGGG + Intergenic
1024922613 7:54575313-54575335 GTTGCTGCTGGTCCTCATGTGGG + Intergenic
1025297365 7:57786691-57786713 GTGGCTGGAGATTCACATCTGGG - Intergenic
1026956717 7:74380924-74380946 CTTCCTGCTGGGTCACATTTTGG + Intronic
1027965228 7:84996309-84996331 TTTGCTTTTGGTTCATATTTTGG - Exonic
1028684091 7:93574150-93574172 GGTGCTTGTGGTTCTCATGTAGG - Intronic
1030362894 7:108613777-108613799 GTTGCATGTGGTTAACAATTTGG + Intergenic
1032062091 7:128733441-128733463 GTTGCTGGTGTGACATATTTGGG - Intergenic
1032421059 7:131779552-131779574 GTTACCTGTGGTTGACATTTGGG + Intergenic
1032875422 7:136033150-136033172 ATTGCAGGAGGTTGACATTTGGG + Intergenic
1037201114 8:16253220-16253242 GGTGCTTGTGGTTCAGATTAGGG - Intronic
1037659179 8:20912458-20912480 GATGCTGGTGGTTCTCAGATTGG + Intergenic
1037734816 8:21557199-21557221 GCTGCTGGTAGTTCACAATAGGG + Intergenic
1042830893 8:73027159-73027181 CTTGCTGATGATTAACATTTAGG + Intronic
1046088135 8:109464558-109464580 GTTGCTGGTGGCACTCACTTTGG + Exonic
1047073571 8:121375128-121375150 GTTTCTGGTGGTCAAAATTTGGG - Intergenic
1052138784 9:24950585-24950607 GTGGTTGGTATTTCACATTTAGG + Intergenic
1053062633 9:35043953-35043975 GATGCTGGTGGGACACATTCAGG - Exonic
1054077357 9:60550230-60550252 GTATCTGGTAGTTGACATTTGGG - Intergenic
1054082834 9:60643941-60643963 GTATCTGGTAGTTGACATTTGGG - Intergenic
1058947178 9:109868616-109868638 CTTGCTGATGGTTCTCATTTTGG - Intronic
1059941035 9:119360207-119360229 TTTGCTGCTGGGACACATTTTGG - Intronic
1060212613 9:121719809-121719831 GTTGCTGGTGGTTCACATTTTGG - Intronic
1185951545 X:4440935-4440957 GTTTCTGGGTGTTAACATTTTGG + Intergenic
1186431037 X:9504158-9504180 TTTGCTGGTGGTTCACCTTCAGG - Intronic
1187326430 X:18294964-18294986 ATTGCTAGTGGTGCACACTTAGG - Intronic
1187711423 X:22058155-22058177 CTTGCAGGTGGTTCAAGTTTGGG + Intronic
1189623394 X:42868684-42868706 AGTGCTGGTGGTAGACATTTGGG + Intergenic
1189687566 X:43581382-43581404 GTAGCTGCTGGTTCACAAATTGG + Intergenic
1190254617 X:48753330-48753352 GATGCTGGAGGTGCACATTCAGG - Intergenic
1190992299 X:55565180-55565202 GATGATGGTGGTTCACTTTTTGG + Intergenic
1192707125 X:73538071-73538093 GCTGCTACTGGTCCACATTTGGG - Intergenic
1193415213 X:81214028-81214050 TTTGCTGAATGTTCACATTTCGG + Intronic
1193474709 X:81948960-81948982 GATTTTGGGGGTTCACATTTTGG + Intergenic
1196433427 X:115652304-115652326 GTAGCTGGTGGGACACATTATGG - Intergenic
1196633784 X:117975836-117975858 GTTTGTGGTGGTTCCCTTTTTGG - Intronic
1196635970 X:118003046-118003068 GTTTCTGCTGCTTCTCATTTTGG - Intronic
1197218085 X:123885580-123885602 GTTGCTTGTGTTTCACATTTTGG + Intronic
1198958854 X:142162227-142162249 GTTGCTGTTGGTTTTGATTTGGG - Intergenic
1200947566 Y:8861891-8861913 GTTGCTTCTGCTACACATTTTGG + Intergenic
1201738097 Y:17292608-17292630 GTTTCTGGGTGTTAACATTTGGG + Intergenic