ID: 1060213224

View in Genome Browser
Species Human (GRCh38)
Location 9:121723160-121723182
Sequence CTGTGGCTCTGGAAGGAAGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1060213214_1060213224 16 Left 1060213214 9:121723121-121723143 CCATAGCTATGGTGCTGGGTGGC 0: 1
1: 0
2: 1
3: 10
4: 111
Right 1060213224 9:121723160-121723182 CTGTGGCTCTGGAAGGAAGAGGG No data
1060213212_1060213224 17 Left 1060213212 9:121723120-121723142 CCCATAGCTATGGTGCTGGGTGG 0: 1
1: 0
2: 0
3: 9
4: 90
Right 1060213224 9:121723160-121723182 CTGTGGCTCTGGAAGGAAGAGGG No data
1060213220_1060213224 -10 Left 1060213220 9:121723147-121723169 CCATGGACGGAGTCTGTGGCTCT 0: 1
1: 0
2: 0
3: 10
4: 125
Right 1060213224 9:121723160-121723182 CTGTGGCTCTGGAAGGAAGAGGG No data
1060213209_1060213224 25 Left 1060213209 9:121723112-121723134 CCTTTAGTCCCATAGCTATGGTG 0: 1
1: 1
2: 1
3: 3
4: 68
Right 1060213224 9:121723160-121723182 CTGTGGCTCTGGAAGGAAGAGGG No data
1060213217_1060213224 -6 Left 1060213217 9:121723143-121723165 CCCTCCATGGACGGAGTCTGTGG 0: 1
1: 0
2: 0
3: 6
4: 82
Right 1060213224 9:121723160-121723182 CTGTGGCTCTGGAAGGAAGAGGG No data
1060213219_1060213224 -7 Left 1060213219 9:121723144-121723166 CCTCCATGGACGGAGTCTGTGGC 0: 1
1: 0
2: 0
3: 9
4: 75
Right 1060213224 9:121723160-121723182 CTGTGGCTCTGGAAGGAAGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1060213224 Original CRISPR CTGTGGCTCTGGAAGGAAGA GGG Intronic
No off target data available for this crispr