ID: 1060213870

View in Genome Browser
Species Human (GRCh38)
Location 9:121726701-121726723
Sequence GCCCCCACCACATCTGGTGT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1060213858_1060213870 19 Left 1060213858 9:121726659-121726681 CCCAACTAATCGCCTGCTTGGTG 0: 1
1: 0
2: 0
3: 5
4: 53
Right 1060213870 9:121726701-121726723 GCCCCCACCACATCTGGTGTTGG No data
1060213859_1060213870 18 Left 1060213859 9:121726660-121726682 CCAACTAATCGCCTGCTTGGTGT 0: 1
1: 0
2: 0
3: 4
4: 40
Right 1060213870 9:121726701-121726723 GCCCCCACCACATCTGGTGTTGG No data
1060213863_1060213870 7 Left 1060213863 9:121726671-121726693 CCTGCTTGGTGTGTGGGGACAAC 0: 1
1: 1
2: 3
3: 14
4: 113
Right 1060213870 9:121726701-121726723 GCCCCCACCACATCTGGTGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1060213870 Original CRISPR GCCCCCACCACATCTGGTGT TGG Intronic
No off target data available for this crispr