ID: 1060214457

View in Genome Browser
Species Human (GRCh38)
Location 9:121730357-121730379
Sequence CCGGCGGGTGATGCTGTTGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 139
Summary {0: 1, 1: 0, 2: 1, 3: 11, 4: 126}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1060214457_1060214469 30 Left 1060214457 9:121730357-121730379 CCTGCAACAGCATCACCCGCCGG 0: 1
1: 0
2: 1
3: 11
4: 126
Right 1060214469 9:121730410-121730432 CACCAATTATAGCTCCATATTGG No data
1060214457_1060214465 5 Left 1060214457 9:121730357-121730379 CCTGCAACAGCATCACCCGCCGG 0: 1
1: 0
2: 1
3: 11
4: 126
Right 1060214465 9:121730385-121730407 TTGCTGGGCCCTGCACTGCCAGG No data
1060214457_1060214461 -10 Left 1060214457 9:121730357-121730379 CCTGCAACAGCATCACCCGCCGG 0: 1
1: 0
2: 1
3: 11
4: 126
Right 1060214461 9:121730370-121730392 CACCCGCCGGGTCTGTTGCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1060214457 Original CRISPR CCGGCGGGTGATGCTGTTGC AGG (reversed) Intronic
900082664 1:870067-870089 CCGGGTGGGGCTGCTGTTGCGGG - Intergenic
901090507 1:6637721-6637743 CCGGAGGGTCATGCCGTTTCAGG - Intronic
902856478 1:19210034-19210056 CTGGCGGGCGACGCTGTTGTGGG - Intronic
903331004 1:22597328-22597350 CCGGGGGGTGATGCAGAGGCAGG - Exonic
903683405 1:25112878-25112900 CCGGATGCTGCTGCTGTTGCTGG + Intergenic
904370247 1:30043663-30043685 CCTGCGGGTGATGATGTTGCAGG - Intergenic
905412696 1:37782663-37782685 CCGGCGGTTGGTGCTGGAGCTGG - Intergenic
906209678 1:44005594-44005616 CCGTCTGGTGCTGCTGTTGCTGG - Intronic
907905657 1:58782446-58782468 GCGGCGGCTGCTGCTGCTGCTGG + Exonic
908698983 1:66877403-66877425 CCCTTGGGTGATTCTGTTGCAGG - Intronic
910911989 1:92244964-92244986 CCTGCGGGAGTTGCTGTTTCAGG + Intronic
914779366 1:150770967-150770989 CCTGCTGGTGCTGCTGCTGCTGG - Intergenic
916241712 1:162646852-162646874 CCCTCAGGTGATTCTGTTGCAGG + Intronic
919075665 1:192809529-192809551 CTGGAAGGTGATGCTCTTGCTGG + Intronic
920307369 1:205027551-205027573 CCTCCAGGTGATGCTGATGCAGG + Intergenic
922637710 1:227192332-227192354 CCAGGTGGTGATGCTGCTGCTGG - Intronic
1069784818 10:70981267-70981289 GCTGTGGGTGATGCTGTGGCTGG + Intergenic
1069853148 10:71423559-71423581 CAGGGGGGTGATGCATTTGCTGG + Intronic
1071695306 10:87863546-87863568 CCGGCGGGCGGTGATGTGGCGGG + Exonic
1072169919 10:92848872-92848894 CCGGTGGGTGTGGCTGCTGCAGG + Intronic
1077103313 11:831639-831661 CCTGCTGCTGCTGCTGTTGCTGG + Exonic
1077181795 11:1220223-1220245 CTGGCGGGCGAGGCTGTTCCAGG + Intergenic
1077917986 11:6623304-6623326 CTGGTGGGTGCTGCTGATGCTGG - Exonic
1078053681 11:7989091-7989113 CCGGCACTTAATGCTGTTGCTGG - Intronic
1078390709 11:10933175-10933197 CCACAGGGTGCTGCTGTTGCAGG - Intergenic
1083155156 11:60818315-60818337 CTGGTGGGTGATGCTATTGTGGG - Intergenic
1083764577 11:64835803-64835825 CCGGCAGGTGACGCAGCTGCAGG - Exonic
1084423101 11:69070658-69070680 CCCTCGGGTGAAGCTGTTGGTGG - Intronic
1084423140 11:69070771-69070793 CCCTCGGGTGAAGCTGTTGGTGG - Intronic
1094201378 12:27797907-27797929 CTGGCGGGTGACGGTGTTGTAGG - Exonic
1095409302 12:41904782-41904804 CTTGCAGGTGATGCTGATGCTGG + Intergenic
1100266072 12:92978006-92978028 TCGGCGGGAGATGCTCTTCCTGG - Intergenic
1101884229 12:108648025-108648047 CTGGAGAGTGCTGCTGTTGCCGG - Intronic
1103308911 12:119989290-119989312 ACGGCGGCTGCTGCTGCTGCAGG - Intergenic
1103308931 12:119989380-119989402 CCTGCTGCTGCTGCTGTTGCCGG - Intergenic
1103848196 12:123914359-123914381 CCGGCGCGTGAAGCTGCTGGGGG + Exonic
1104502885 12:129303139-129303161 CCGGCGAGTGATGATGGTGGAGG - Intronic
1104502891 12:129303174-129303196 CCGGCGAGTGATGATGGTGGAGG - Intronic
1104502897 12:129303209-129303231 CCGGCGAGTGATGATGGTGGAGG - Intronic
1104502903 12:129303244-129303266 CCGGCGAGTGATGATGGTGGAGG - Intronic
1104502909 12:129303279-129303301 CCGGCGAGTGATGATGGTGGAGG - Intronic
1104502915 12:129303314-129303336 CCGGCGAGTGATGATGGTGGAGG - Intronic
1104502921 12:129303349-129303371 CCGGCGAGTGATGATGGTGGAGG - Intronic
1104502927 12:129303384-129303406 CCGGCGAGTGATGATGGTGGAGG - Intronic
1104502933 12:129303419-129303441 CCGGCGAGTGATGATGGTGGAGG - Intronic
1104502939 12:129303454-129303476 CCGGCGAGTGATGATGGTGGAGG - Intronic
1104502945 12:129303489-129303511 CCGGCGAGTGATGATGGTGGAGG - Intronic
1104502951 12:129303524-129303546 CCGGCGAGTGATGATGGTGGAGG - Intronic
1104502957 12:129303559-129303581 CCGGCGAGTGATGATGGTGGAGG - Intronic
1104502963 12:129303594-129303616 CCGGCGAGTGATGATGGTGGAGG - Intronic
1104759615 12:131289158-131289180 CCATCGGCTGCTGCTGTTGCTGG - Intergenic
1104925458 12:132311743-132311765 CCGGAAGGTGATGGTGCTGCTGG - Intronic
1106257272 13:28032911-28032933 CCAGCTGGAGATGCTTTTGCTGG + Intronic
1107631278 13:42344857-42344879 CCTTGGGGTGATGCTGTTGGAGG + Intergenic
1110499706 13:76212995-76213017 CCTGCTGGTCATGCTGTTGTAGG + Intergenic
1112200340 13:97268426-97268448 CCAGCGGATGCTGCTGCTGCTGG + Intronic
1114604978 14:23989006-23989028 CCGGCGGGTCATCCTGGAGCTGG - Exonic
1116711495 14:48373402-48373424 ATGGCAGGTGATGCTGTTCCTGG - Intergenic
1117957091 14:61131150-61131172 CCTGTGGCTGATGCTGTGGCCGG - Intergenic
1122864455 14:104597246-104597268 CCGGGGGGTGCTGCTGGTGGGGG - Intronic
1122975267 14:105168369-105168391 CCGGCGGCTGCTGCTGCTGCTGG - Exonic
1202862484 14_GL000225v1_random:91040-91062 CCTGTGGGTGTCGCTGTTGCCGG + Intergenic
1125577151 15:40763890-40763912 CCGCCGAGTGATCCAGTTGCGGG - Intergenic
1127428578 15:58880434-58880456 CCAGCTGGTGCTGCTGCTGCTGG - Intronic
1128758085 15:70196609-70196631 CCAGCGGGTGCTGCTGGTGCTGG - Intergenic
1129603914 15:77015570-77015592 CCTGGGGGTGATGCTGATGCTGG + Intronic
1131270286 15:90943047-90943069 CCAGAGGGTGAGGCTGTTGTTGG - Exonic
1132375710 15:101327020-101327042 CCGCCTGGTGGGGCTGTTGCTGG + Intronic
1136282126 16:29220183-29220205 CCGGAGGCTGCTGCTGTTCCTGG + Intergenic
1137984857 16:53099199-53099221 GCGGCAGTTGCTGCTGTTGCTGG - Intronic
1141836411 16:86542959-86542981 TCTGCGGGTGATGCTGCTGGTGG - Intronic
1147363252 17:39944422-39944444 CCGGCAGGTGAGGCTGGTGCCGG + Exonic
1147422857 17:40331223-40331245 CGGGCAGGAGCTGCTGTTGCTGG - Exonic
1148126728 17:45241224-45241246 CCTGCGGGTGAGGCTGGGGCGGG + Exonic
1152353380 17:79795376-79795398 GCGGCAGGTGCTGCTGGTGCTGG + Exonic
1152888732 17:82867872-82867894 CCTGCCGGTGATGGTGCTGCCGG + Intronic
1157880280 18:51314864-51314886 CTCGCTGGTGATGCTGGTGCTGG + Intergenic
1158934762 18:62354415-62354437 CCGGGGGGTCGTGCTGTTGCCGG - Exonic
1160139878 18:76311900-76311922 ACGCCTGGTGATGCTGATGCCGG + Intergenic
1160531486 18:79567588-79567610 GCGGCTGGTGGTGCTGCTGCGGG + Intergenic
1160662174 19:306268-306290 CCGGCGGAGGCTGCTGGTGCGGG + Exonic
1163833898 19:19562062-19562084 CCAGCAGGTGAGGCAGTTGCAGG + Exonic
1165061114 19:33205643-33205665 CCGGCGGGTGCTGCTGCAGCTGG + Exonic
1167851976 19:52209077-52209099 CCTCCGGGTGATTCTGCTGCAGG + Intronic
1168335938 19:55597819-55597841 GCGGCGGGCGGTGCTGGTGCAGG + Exonic
926086932 2:10026316-10026338 CAGGGGGGTGCTCCTGTTGCCGG + Intergenic
928085140 2:28341338-28341360 CCGGCTTCTGTTGCTGTTGCGGG - Intergenic
935592414 2:104855207-104855229 CCTGCGGCTGCTGCTGCTGCTGG + Intergenic
938698323 2:133854493-133854515 CCAGGGGGTGATGCTGCTGCTGG - Intergenic
942461170 2:176169845-176169867 CAGGCTGCTGGTGCTGTTGCTGG + Intronic
944399551 2:199309541-199309563 CCTGCAGGTGTGGCTGTTGCGGG - Intronic
945119462 2:206443397-206443419 TCGGGTGCTGATGCTGTTGCTGG - Intergenic
947542884 2:230990851-230990873 CCCGGGCGTGCTGCTGTTGCAGG - Intergenic
948564509 2:238875358-238875380 CCAGTGGGTGGTGCTGTTGGAGG - Intronic
1169227514 20:3865689-3865711 CCGGCGGGTGTTGGAGCTGCTGG - Exonic
1176089984 20:63314439-63314461 ACGGTGGGAGCTGCTGTTGCTGG + Intronic
1180614981 22:17120963-17120985 CCCGCGGCTGGTGCTGGTGCTGG + Exonic
1181456374 22:23062323-23062345 CCGGCAGCTGCTGCTGTTGGGGG - Intronic
1184236368 22:43185394-43185416 CTGGCAGGTGCTGCTGCTGCTGG + Intronic
954003675 3:47577006-47577028 CCTGAGGGCGATGCTGCTGCCGG + Exonic
956952634 3:74299730-74299752 CTGGTGGGTGCTGCTGCTGCTGG - Intronic
958580082 3:96007359-96007381 TGGGTGGGTGTTGCTGTTGCTGG - Intergenic
960639426 3:119812005-119812027 CCCCCCGGTGATTCTGTTGCAGG + Intronic
963188513 3:142443566-142443588 CCGAAGGGGGTTGCTGTTGCCGG - Intronic
969235649 4:5863615-5863637 CCGGGAGGTGATGGTGTTGGGGG - Intronic
971417984 4:26451105-26451127 CCCTCAGGTGATTCTGTTGCAGG - Intergenic
975148591 4:70996101-70996123 CAGGCGGCTGATGCTGATGTGGG + Intronic
984992783 4:185396914-185396936 TAGGCGGGAAATGCTGTTGCTGG + Exonic
985616060 5:922691-922713 CCCGAGGGTGATGCTTCTGCTGG + Intergenic
987235415 5:15937020-15937042 CTGGCCGGTGATGCTCTCGCAGG - Exonic
993386601 5:87268755-87268777 GTGGCCGGTGCTGCTGTTGCTGG + Exonic
995525820 5:113049824-113049846 CTGGAGGTTGATGCTGCTGCAGG - Intronic
995890050 5:116940880-116940902 CCGGTGGGAGATGCTATGGCTGG + Intergenic
1000369032 5:160517393-160517415 CTGGCGGTCAATGCTGTTGCTGG + Intergenic
1002946401 6:1765617-1765639 CCGCCGCGTGACCCTGTTGCAGG - Intronic
1004319623 6:14622175-14622197 CCGGCTGGTGAGGCTCCTGCTGG - Intergenic
1004763669 6:18699840-18699862 CTGCCAGGTGATGCTGATGCTGG - Intergenic
1005298189 6:24446822-24446844 CCAGCAGGTGAGGCTGATGCTGG - Exonic
1006132728 6:31878738-31878760 CCGGGGGCTGGGGCTGTTGCTGG - Intronic
1008092772 6:47309452-47309474 TCGGCGGGCGATGCGGCTGCAGG + Exonic
1015003967 6:128255785-128255807 CCTGCAGGTGATACTGATGCAGG + Intronic
1018705385 6:166460415-166460437 CAGGCGGGTGATGCTGCAGGTGG + Intronic
1021986393 7:26102006-26102028 CCACCGGGTGATTCTGATGCAGG - Intergenic
1023581664 7:41690381-41690403 CCTGCGGGTGCTTCTGCTGCTGG + Exonic
1035296683 7:157871327-157871349 CCTGCAGGTGATTCTGATGCAGG + Intronic
1037606116 8:20438592-20438614 GGGGCTGGTGATGCTGGTGCTGG + Intergenic
1039989319 8:42474851-42474873 CCGGCGGGACATGGTGTAGCAGG + Intronic
1041108007 8:54459713-54459735 CCGGGGGGTGGTGCTGGTGCTGG - Exonic
1045788653 8:105955695-105955717 CCAAAGGGTGTTGCTGTTGCCGG + Intergenic
1049075117 8:140389464-140389486 CAGGCGAGTGGTGCTGATGCTGG + Intronic
1050269591 9:3928130-3928152 ACGGAGAGTGATGCTGTTACGGG - Intronic
1051222858 9:14868885-14868907 CCCGCGGTTGATGCTGATGAAGG + Exonic
1059299532 9:113300918-113300940 CAGGCGTGTGATGGTGGTGCAGG + Intronic
1060214457 9:121730357-121730379 CCGGCGGGTGATGCTGTTGCAGG - Intronic
1060237600 9:121876879-121876901 CCTGCGGGTGATTCTGATACGGG + Intronic
1186501669 X:10055667-10055689 TCTGGGGTTGATGCTGTTGCGGG + Intronic
1187120766 X:16404045-16404067 CCCCTGGGTGATGCTGATGCTGG + Intergenic
1199950996 X:152706213-152706235 CCAGCTGGTGATGATGTTGCCGG - Intergenic
1199958686 X:152762248-152762270 CCAGCTGGTGATGATGTTGCCGG + Intergenic