ID: 1060216216

View in Genome Browser
Species Human (GRCh38)
Location 9:121740021-121740043
Sequence GACCCCACTGGGTCTCCTTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 144
Summary {0: 1, 1: 0, 2: 0, 3: 16, 4: 127}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1060216216_1060216224 19 Left 1060216216 9:121740021-121740043 CCTCAAGGAGACCCAGTGGGGTC 0: 1
1: 0
2: 0
3: 16
4: 127
Right 1060216224 9:121740063-121740085 AGTAGGAAAAGGAGGTGAGAAGG No data
1060216216_1060216226 25 Left 1060216216 9:121740021-121740043 CCTCAAGGAGACCCAGTGGGGTC 0: 1
1: 0
2: 0
3: 16
4: 127
Right 1060216226 9:121740069-121740091 AAAAGGAGGTGAGAAGGTGGCGG No data
1060216216_1060216222 8 Left 1060216216 9:121740021-121740043 CCTCAAGGAGACCCAGTGGGGTC 0: 1
1: 0
2: 0
3: 16
4: 127
Right 1060216222 9:121740052-121740074 CAGGTGTGTTGAGTAGGAAAAGG No data
1060216216_1060216225 22 Left 1060216216 9:121740021-121740043 CCTCAAGGAGACCCAGTGGGGTC 0: 1
1: 0
2: 0
3: 16
4: 127
Right 1060216225 9:121740066-121740088 AGGAAAAGGAGGTGAGAAGGTGG No data
1060216216_1060216227 26 Left 1060216216 9:121740021-121740043 CCTCAAGGAGACCCAGTGGGGTC 0: 1
1: 0
2: 0
3: 16
4: 127
Right 1060216227 9:121740070-121740092 AAAGGAGGTGAGAAGGTGGCGGG No data
1060216216_1060216223 11 Left 1060216216 9:121740021-121740043 CCTCAAGGAGACCCAGTGGGGTC 0: 1
1: 0
2: 0
3: 16
4: 127
Right 1060216223 9:121740055-121740077 GTGTGTTGAGTAGGAAAAGGAGG No data
1060216216_1060216221 2 Left 1060216216 9:121740021-121740043 CCTCAAGGAGACCCAGTGGGGTC 0: 1
1: 0
2: 0
3: 16
4: 127
Right 1060216221 9:121740046-121740068 AACAGACAGGTGTGTTGAGTAGG No data
1060216216_1060216228 27 Left 1060216216 9:121740021-121740043 CCTCAAGGAGACCCAGTGGGGTC 0: 1
1: 0
2: 0
3: 16
4: 127
Right 1060216228 9:121740071-121740093 AAGGAGGTGAGAAGGTGGCGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1060216216 Original CRISPR GACCCCACTGGGTCTCCTTG AGG (reversed) Intronic
901841556 1:11957080-11957102 GACCCCACAGTGTCTCCCTGGGG + Intronic
901949144 1:12727512-12727534 GGCCCCACTTGGTCTTCTGGAGG + Exonic
902382094 1:16057582-16057604 GACCCAAGTGTGGCTCCTTGGGG + Intergenic
903918179 1:26779790-26779812 GACCCCACTGTGTACCCTTCTGG + Exonic
905505269 1:38474475-38474497 GACCCGATGGAGTCTCCTTGTGG + Intergenic
907283981 1:53368700-53368722 GACCCCACAGTTTCTCCTAGGGG - Intergenic
912420438 1:109539102-109539124 GCCCCCACTCTGTCTCCTTCAGG + Intergenic
912661830 1:111538586-111538608 AAGCCCACTGAGTCTCCTTTGGG + Intronic
915107033 1:153541121-153541143 GTCCCAGCTGAGTCTCCTTGAGG - Intronic
919238485 1:194878630-194878652 GAGCACACTGGGTGTACTTGAGG - Intergenic
922499490 1:226085966-226085988 GAGCCCACTGTGGCTCCTTGGGG - Intergenic
923031066 1:230249345-230249367 GCCCCCACTGGGTCTCCAGGCGG - Intronic
924774761 1:247108323-247108345 GGCCCCAGTGGGTCTTGTTGAGG + Intergenic
1063049621 10:2432981-2433003 CTCCCCACTGGGTCTCCCTAGGG + Intergenic
1070275245 10:74999697-74999719 TACCCCATAGGGTCTCCGTGAGG - Intronic
1070284147 10:75071385-75071407 GACTCAACTGGGCCTCCCTGGGG + Intergenic
1070306841 10:75244863-75244885 GGCCCCTCTGGATCTCCCTGTGG + Intergenic
1070780772 10:79136268-79136290 CACCCTCCAGGGTCTCCTTGGGG + Intronic
1076036275 10:127201146-127201168 GGCCCCACTGGGGCACCTTGAGG - Intronic
1076144328 10:128105148-128105170 GTACCCACTGGGTCTGGTTGTGG + Exonic
1076687596 10:132205063-132205085 CTCCCCACAGGCTCTCCTTGTGG + Exonic
1077042030 11:529106-529128 CACCCCACGGGGTCGCCGTGAGG - Intergenic
1078107659 11:8368703-8368725 AACCAGACTGGGGCTCCTTGAGG - Intergenic
1078544320 11:12235734-12235756 GACCCCAGCTGGTCTCCATGAGG + Intronic
1080441437 11:32298549-32298571 GAGCCTACTGGGTCTTCATGGGG + Intergenic
1083887160 11:65578470-65578492 AACCCCTGGGGGTCTCCTTGAGG - Intronic
1084175453 11:67420273-67420295 TACCCCACTGGAGCTCCCTGAGG - Intronic
1084219490 11:67668365-67668387 GACCCCACTGGGGTTCCCTTGGG - Intronic
1089576707 11:119449534-119449556 GAACACACTAGGTGTCCTTGAGG - Intergenic
1096994509 12:55830363-55830385 GACCCAACTGGGTCTACGTGGGG - Intronic
1104017712 12:124971678-124971700 GAAGCCACTGGGACTCCTGGGGG - Intronic
1104666378 12:130650078-130650100 GTCCCCACTGCGTCTCCCCGAGG - Intronic
1106130737 13:26937319-26937341 GGTCCCACTGGGTCTCCTTTAGG + Intergenic
1108903938 13:55447293-55447315 GGTCCCAGTGGGTCTCCTAGAGG + Intergenic
1115648105 14:35384187-35384209 GACCCCTTTGGCCCTCCTTGAGG - Intergenic
1116478052 14:45364750-45364772 GACCTCCCTTGGTCTCCTTGAGG + Intergenic
1118535953 14:66764353-66764375 GTCCTCCCTGGGTATCCTTGAGG - Intronic
1119554453 14:75542563-75542585 GTCCCCTCTGGCCCTCCTTGGGG - Intronic
1124376751 15:29133413-29133435 GACACCAGTGGGTGTCCCTGTGG - Intronic
1126119594 15:45239952-45239974 GGCCCCAGTGGGTCTTGTTGGGG - Intergenic
1132586312 16:707008-707030 GGCGCCACTGGGTCTACCTGGGG + Intronic
1132877047 16:2144593-2144615 GAGCGCCCTGGGTCTCCTTGGGG - Intronic
1133728171 16:8556340-8556362 CTCCCCACTGGGTTTCCTTTTGG + Intergenic
1134156971 16:11851813-11851835 GACCCCACTGGGCCTCCTGACGG - Intergenic
1137658354 16:50180808-50180830 GACCCCACTGCCCCTTCTTGAGG - Intronic
1137904762 16:52309978-52310000 GACCCCACTGTTTCTCTGTGTGG - Intergenic
1138530498 16:57631823-57631845 GCCCCATCTGGGGCTCCTTGAGG + Intronic
1141014869 16:80439524-80439546 TACCTCACAGGGTCTTCTTGAGG + Intergenic
1144803654 17:17949389-17949411 GACCCAGTTGGGCCTCCTTGGGG - Intronic
1147907301 17:43831731-43831753 GGCCCCACTCGGGCTCCTCGGGG - Intronic
1152290453 17:79437184-79437206 GACCCCAGGGGGGCTCCTGGGGG - Intronic
1152298551 17:79482493-79482515 GGCCCCAGTGGGGCTCCTTCTGG + Exonic
1155366319 18:25052321-25052343 TATCCATCTGGGTCTCCTTGGGG + Intergenic
1160897098 19:1408038-1408060 GACCCCTCAGGCTCTCCTTCAGG - Intronic
1162524731 19:11200810-11200832 CACCCCACAGGGTCCCCTGGAGG - Exonic
1164708830 19:30339961-30339983 GTGCCCACTGGTCCTCCTTGAGG - Intronic
1166161529 19:40957244-40957266 GGCCCCAGTGGGTCTTGTTGGGG + Intergenic
1166782233 19:45348744-45348766 GACCCCACTTCGTCTCCCTGGGG - Intronic
925131250 2:1495737-1495759 GACGCCACAGGGTCTCCTTCAGG + Intronic
925131269 2:1495808-1495830 GACGCCACAGGGTCTCCTTCAGG + Intronic
925146370 2:1585768-1585790 GCCCCCACGGTCTCTCCTTGGGG - Intergenic
925944290 2:8846461-8846483 CACCCCACTGAGTCTCAGTGGGG + Intergenic
925944291 2:8846463-8846485 GACCCCACTGAGACTCAGTGGGG - Intergenic
927078820 2:19607775-19607797 GACACCACTGAGCCTCCCTGTGG + Intergenic
932177667 2:69617550-69617572 GACCCAACTTGGACTCCTTGAGG - Intronic
933897065 2:86821522-86821544 GATCACACTGGGGCTCCTTCAGG + Intronic
934760413 2:96852600-96852622 GCCCCCACTTGGAGTCCTTGAGG - Intronic
934777522 2:96948883-96948905 GAGCCCAGTGGGACTCCTGGGGG + Intronic
937289986 2:120776344-120776366 GAGCCCACTGGGCCTCCCTTTGG - Intronic
937975833 2:127581677-127581699 GCCCTCAGTGGGTCTCCTGGGGG - Intronic
942949703 2:181708415-181708437 GTCCCCTCTGCATCTCCTTGTGG - Intergenic
943764983 2:191651040-191651062 GACCTCACTAGGTTTCCCTGAGG + Intergenic
944318820 2:198312209-198312231 GACCTCACTTTGTCTTCTTGTGG - Intronic
946001569 2:216486765-216486787 GGCACCACTGGGTCTCCTGCTGG - Intergenic
947715957 2:232338933-232338955 TCCCCCACGGTGTCTCCTTGAGG - Intronic
948913713 2:241019469-241019491 GACCCCACTGGTGGTCCTGGGGG + Intronic
949014574 2:241702179-241702201 GAGCCCACGGGGTCTGCATGCGG - Intronic
1169111810 20:3038917-3038939 GTCCTCACTGAGTCTCCTTAAGG + Intronic
1172174087 20:32961722-32961744 CACCCCACTGGGCCTCTCTGGGG + Intergenic
1172865743 20:38095634-38095656 GACCTCTCTGGGTCTGCTGGGGG - Intronic
1173271458 20:41539552-41539574 CACCCCACTGGGGCCCCATGAGG + Intronic
1174507719 20:51027423-51027445 GATCCCACTGGGTGTCTGTGGGG + Intergenic
1176033070 20:63023202-63023224 GACCCAGCTGGGTCTCCTGTGGG - Intergenic
1176117594 20:63439832-63439854 GGCCTCACTGGGCCTCCGTGTGG - Intronic
1178453601 21:32727562-32727584 GACCCGACTGGGGCTCCTCGGGG + Intronic
1178859758 21:36278971-36278993 GAGCCCACTGGGTGACCCTGGGG + Intronic
1179801161 21:43812040-43812062 GGCCACACGGGGTCTCCCTGAGG + Intergenic
1183192310 22:36329483-36329505 TCCCCCACTGCGTCTCCCTGTGG + Intronic
1183348073 22:37318888-37318910 GACTCCACAGGGCCTCTTTGGGG + Intergenic
1184273749 22:43399013-43399035 AGCCCCACTGGGTGTCCTGGAGG + Intergenic
949121437 3:389309-389331 CACTCCACTGGGGCTCCCTGTGG - Exonic
952209627 3:31216448-31216470 GGCACCACTGGTTCTTCTTGTGG + Intergenic
960550030 3:118965287-118965309 CATCCCACTGGGTCTCTTTAGGG - Intronic
968453444 4:685888-685910 GAACCCTCTGGGCGTCCTTGTGG - Exonic
968595605 4:1480877-1480899 ACCCCCAGTGGGTTTCCTTGTGG - Intergenic
977508186 4:97929044-97929066 GTACACACTGGGTCTACTTGAGG - Intronic
979439390 4:120733522-120733544 GACCCTACCTGGTCTCCCTGGGG + Intronic
982205897 4:152996858-152996880 TACCCCACTGAGCCTCCTAGGGG - Intergenic
983660989 4:170130758-170130780 GGCCCCAGTGGGTCTTGTTGGGG - Intergenic
988776272 5:34480439-34480461 AAGCCCACTGGGTCCCCGTGAGG - Intergenic
989524759 5:42440988-42441010 GACTGCACTGTGTCTCTTTGAGG - Intronic
994009047 5:94878372-94878394 GTCCCCACTGGGTCTGATTCTGG + Intronic
995482020 5:112602943-112602965 GACCCCACCAGGTTTCCTTTTGG + Intergenic
998133020 5:139660642-139660664 GAGCCCACTGTGTGACCTTGGGG - Intronic
998421913 5:141995308-141995330 GAACCTAGTGGGTCTCCTCGAGG - Intronic
998527997 5:142860071-142860093 GGGCGCACTGGGGCTCCTTGTGG - Intronic
998617495 5:143756649-143756671 AACGCCATTGGGTCTCCTTATGG + Intergenic
1002192279 5:177484521-177484543 GGCCCCACTGGATTTCCTGGTGG - Intronic
1006397753 6:33798127-33798149 TAACCCACCGCGTCTCCTTGCGG + Intronic
1008222945 6:48876655-48876677 GGCCCCAGTGGGTCTTATTGGGG + Intergenic
1008752594 6:54754888-54754910 TAGCTCAGTGGGTCTCCTTGAGG + Intergenic
1011809010 6:91108342-91108364 TACCCCACAGGGTCACCATGAGG - Intergenic
1016927022 6:149361147-149361169 GGCCCCACAGAGTCTCCATGGGG - Intronic
1016987356 6:149905387-149905409 GGCTCCCCTGGGTCTCCTTCAGG - Intergenic
1017790996 6:157799385-157799407 TCACCCAGTGGGTCTCCTTGGGG + Intronic
1017812605 6:157994873-157994895 GAACCCCCTGGGACTCCCTGGGG - Intronic
1022795424 7:33727890-33727912 TACCCCTCAGGCTCTCCTTGTGG + Exonic
1023955643 7:44884925-44884947 GGCCGCGCTGGTTCTCCTTGAGG + Exonic
1026020048 7:66699125-66699147 GGCCCCTCTGGGTTTCCTCGTGG + Intronic
1027235937 7:76297829-76297851 GAGCCCAGTGGGTCTCATTTGGG - Intergenic
1034471418 7:151256571-151256593 CACCCCACCCGGTCTCATTGTGG + Intronic
1034499318 7:151439857-151439879 AGCCCCACTCGGTTTCCTTGGGG + Intronic
1034952215 7:155306443-155306465 GGCCCCACTGGGCCACCTGGAGG + Intronic
1040661198 8:49577781-49577803 GACCCAAGTGATTCTCCTTGAGG - Intergenic
1041643629 8:60229341-60229363 GACCCCAGTCTGTCTCCCTGGGG - Intronic
1043694380 8:83201577-83201599 GACCCCACTGGGACTGCATATGG - Intergenic
1048519084 8:135137301-135137323 TAGCCCAGTGGGTCTCCTTGTGG + Intergenic
1048920847 8:139228719-139228741 GACCTCACTGGATCTCATTACGG + Intergenic
1049807325 8:144546922-144546944 CACCCCACGGGGCCTCCTCGTGG + Intronic
1054769722 9:69072088-69072110 AACAGCACTGGGTCTCCTTTTGG + Intronic
1056767653 9:89454832-89454854 GGCCCCACTGGGTCAGCTGGGGG - Intronic
1058653095 9:107195498-107195520 GTCCTCAGTGGGTCTCCTTGTGG - Intergenic
1058896064 9:109401625-109401647 GAGCCCACAGCGCCTCCTTGTGG + Intronic
1060216216 9:121740021-121740043 GACCCCACTGGGTCTCCTTGAGG - Intronic
1061281840 9:129602041-129602063 GACACCCCTGGGTCTACCTGGGG - Intergenic
1061897208 9:133654730-133654752 GACCTCACTGTATCTCCTGGTGG - Intronic
1185983600 X:4806480-4806502 GACACCACTGGCTTTCCTGGAGG - Intergenic
1186187126 X:7031512-7031534 GACCTAACTGGCTGTCCTTGTGG - Intergenic
1189103302 X:38212780-38212802 GACCCCACTTGCTCTTTTTGAGG - Intronic
1189327142 X:40119687-40119709 GAGCACAGTGGGACTCCTTGGGG + Intronic
1191129303 X:56991290-56991312 GACCCAACTATCTCTCCTTGGGG - Intronic
1200063243 X:153492876-153492898 ACCCCCACTGGGACTCCTGGAGG + Intronic
1200961246 Y:8998058-8998080 GGCCCCAGTAGGTCTTCTTGGGG + Intergenic
1202151527 Y:21848173-21848195 GGCCCCAGTGGGTCTTTTTGGGG - Intergenic