ID: 1060220628 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 9:121762369-121762391 |
Sequence | TCAGAGGTGCATCTCCCCCG GGG (reversed) |
Strand | - |
Crispr in exon? | No |
Crispr in intron? | Yes |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | ||||
Summary |
Found 3 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1060220628_1060220638 | 27 | Left | 1060220628 | 9:121762369-121762391 | CCCCGGGGGAGATGCACCTCTGA | No data | ||
Right | 1060220638 | 9:121762419-121762441 | AGACCCTGGAGGTCGCCTGCTGG | No data | ||||
1060220628_1060220637 | 16 | Left | 1060220628 | 9:121762369-121762391 | CCCCGGGGGAGATGCACCTCTGA | No data | ||
Right | 1060220637 | 9:121762408-121762430 | TTCAGAGAATGAGACCCTGGAGG | No data | ||||
1060220628_1060220636 | 13 | Left | 1060220628 | 9:121762369-121762391 | CCCCGGGGGAGATGCACCTCTGA | No data | ||
Right | 1060220636 | 9:121762405-121762427 | GTATTCAGAGAATGAGACCCTGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1060220628 | Original CRISPR | TCAGAGGTGCATCTCCCCCG GGG (reversed) | Intronic | ||