ID: 1060220629

View in Genome Browser
Species Human (GRCh38)
Location 9:121762370-121762392
Sequence GTCAGAGGTGCATCTCCCCC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1060220629_1060220636 12 Left 1060220629 9:121762370-121762392 CCCGGGGGAGATGCACCTCTGAC No data
Right 1060220636 9:121762405-121762427 GTATTCAGAGAATGAGACCCTGG No data
1060220629_1060220637 15 Left 1060220629 9:121762370-121762392 CCCGGGGGAGATGCACCTCTGAC No data
Right 1060220637 9:121762408-121762430 TTCAGAGAATGAGACCCTGGAGG No data
1060220629_1060220638 26 Left 1060220629 9:121762370-121762392 CCCGGGGGAGATGCACCTCTGAC No data
Right 1060220638 9:121762419-121762441 AGACCCTGGAGGTCGCCTGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1060220629 Original CRISPR GTCAGAGGTGCATCTCCCCC GGG (reversed) Intronic