ID: 1060220633

View in Genome Browser
Species Human (GRCh38)
Location 9:121762393-121762415
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1060220633_1060220638 3 Left 1060220633 9:121762393-121762415 CCCCGCTTTAGTGTATTCAGAGA No data
Right 1060220638 9:121762419-121762441 AGACCCTGGAGGTCGCCTGCTGG No data
1060220633_1060220644 14 Left 1060220633 9:121762393-121762415 CCCCGCTTTAGTGTATTCAGAGA No data
Right 1060220644 9:121762430-121762452 GTCGCCTGCTGGTCAGGAAGGGG No data
1060220633_1060220643 13 Left 1060220633 9:121762393-121762415 CCCCGCTTTAGTGTATTCAGAGA No data
Right 1060220643 9:121762429-121762451 GGTCGCCTGCTGGTCAGGAAGGG No data
1060220633_1060220641 8 Left 1060220633 9:121762393-121762415 CCCCGCTTTAGTGTATTCAGAGA No data
Right 1060220641 9:121762424-121762446 CTGGAGGTCGCCTGCTGGTCAGG No data
1060220633_1060220646 22 Left 1060220633 9:121762393-121762415 CCCCGCTTTAGTGTATTCAGAGA No data
Right 1060220646 9:121762438-121762460 CTGGTCAGGAAGGGGTCCTCAGG No data
1060220633_1060220642 12 Left 1060220633 9:121762393-121762415 CCCCGCTTTAGTGTATTCAGAGA No data
Right 1060220642 9:121762428-121762450 AGGTCGCCTGCTGGTCAGGAAGG No data
1060220633_1060220637 -8 Left 1060220633 9:121762393-121762415 CCCCGCTTTAGTGTATTCAGAGA No data
Right 1060220637 9:121762408-121762430 TTCAGAGAATGAGACCCTGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1060220633 Original CRISPR TCTCTGAATACACTAAAGCG GGG (reversed) Intronic