ID: 1060220634

View in Genome Browser
Species Human (GRCh38)
Location 9:121762394-121762416
Sequence TTCTCTGAATACACTAAAGC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1060220634_1060220642 11 Left 1060220634 9:121762394-121762416 CCCGCTTTAGTGTATTCAGAGAA No data
Right 1060220642 9:121762428-121762450 AGGTCGCCTGCTGGTCAGGAAGG No data
1060220634_1060220641 7 Left 1060220634 9:121762394-121762416 CCCGCTTTAGTGTATTCAGAGAA No data
Right 1060220641 9:121762424-121762446 CTGGAGGTCGCCTGCTGGTCAGG No data
1060220634_1060220638 2 Left 1060220634 9:121762394-121762416 CCCGCTTTAGTGTATTCAGAGAA No data
Right 1060220638 9:121762419-121762441 AGACCCTGGAGGTCGCCTGCTGG No data
1060220634_1060220637 -9 Left 1060220634 9:121762394-121762416 CCCGCTTTAGTGTATTCAGAGAA No data
Right 1060220637 9:121762408-121762430 TTCAGAGAATGAGACCCTGGAGG No data
1060220634_1060220643 12 Left 1060220634 9:121762394-121762416 CCCGCTTTAGTGTATTCAGAGAA No data
Right 1060220643 9:121762429-121762451 GGTCGCCTGCTGGTCAGGAAGGG No data
1060220634_1060220646 21 Left 1060220634 9:121762394-121762416 CCCGCTTTAGTGTATTCAGAGAA No data
Right 1060220646 9:121762438-121762460 CTGGTCAGGAAGGGGTCCTCAGG No data
1060220634_1060220644 13 Left 1060220634 9:121762394-121762416 CCCGCTTTAGTGTATTCAGAGAA No data
Right 1060220644 9:121762430-121762452 GTCGCCTGCTGGTCAGGAAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1060220634 Original CRISPR TTCTCTGAATACACTAAAGC GGG (reversed) Intronic