ID: 1060220636

View in Genome Browser
Species Human (GRCh38)
Location 9:121762405-121762427
Sequence GTATTCAGAGAATGAGACCC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1060220632_1060220636 -10 Left 1060220632 9:121762392-121762414 CCCCCGCTTTAGTGTATTCAGAG No data
Right 1060220636 9:121762405-121762427 GTATTCAGAGAATGAGACCCTGG No data
1060220631_1060220636 -3 Left 1060220631 9:121762385-121762407 CCTCTGACCCCCGCTTTAGTGTA No data
Right 1060220636 9:121762405-121762427 GTATTCAGAGAATGAGACCCTGG No data
1060220629_1060220636 12 Left 1060220629 9:121762370-121762392 CCCGGGGGAGATGCACCTCTGAC No data
Right 1060220636 9:121762405-121762427 GTATTCAGAGAATGAGACCCTGG No data
1060220627_1060220636 23 Left 1060220627 9:121762359-121762381 CCTGGAGGAGCCCCGGGGGAGAT No data
Right 1060220636 9:121762405-121762427 GTATTCAGAGAATGAGACCCTGG No data
1060220630_1060220636 11 Left 1060220630 9:121762371-121762393 CCGGGGGAGATGCACCTCTGACC No data
Right 1060220636 9:121762405-121762427 GTATTCAGAGAATGAGACCCTGG No data
1060220628_1060220636 13 Left 1060220628 9:121762369-121762391 CCCCGGGGGAGATGCACCTCTGA No data
Right 1060220636 9:121762405-121762427 GTATTCAGAGAATGAGACCCTGG No data
1060220626_1060220636 24 Left 1060220626 9:121762358-121762380 CCCTGGAGGAGCCCCGGGGGAGA No data
Right 1060220636 9:121762405-121762427 GTATTCAGAGAATGAGACCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1060220636 Original CRISPR GTATTCAGAGAATGAGACCC TGG Intronic