ID: 1060220638

View in Genome Browser
Species Human (GRCh38)
Location 9:121762419-121762441
Sequence AGACCCTGGAGGTCGCCTGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1060220633_1060220638 3 Left 1060220633 9:121762393-121762415 CCCCGCTTTAGTGTATTCAGAGA No data
Right 1060220638 9:121762419-121762441 AGACCCTGGAGGTCGCCTGCTGG No data
1060220629_1060220638 26 Left 1060220629 9:121762370-121762392 CCCGGGGGAGATGCACCTCTGAC No data
Right 1060220638 9:121762419-121762441 AGACCCTGGAGGTCGCCTGCTGG No data
1060220635_1060220638 1 Left 1060220635 9:121762395-121762417 CCGCTTTAGTGTATTCAGAGAAT No data
Right 1060220638 9:121762419-121762441 AGACCCTGGAGGTCGCCTGCTGG No data
1060220632_1060220638 4 Left 1060220632 9:121762392-121762414 CCCCCGCTTTAGTGTATTCAGAG No data
Right 1060220638 9:121762419-121762441 AGACCCTGGAGGTCGCCTGCTGG No data
1060220630_1060220638 25 Left 1060220630 9:121762371-121762393 CCGGGGGAGATGCACCTCTGACC No data
Right 1060220638 9:121762419-121762441 AGACCCTGGAGGTCGCCTGCTGG No data
1060220634_1060220638 2 Left 1060220634 9:121762394-121762416 CCCGCTTTAGTGTATTCAGAGAA No data
Right 1060220638 9:121762419-121762441 AGACCCTGGAGGTCGCCTGCTGG No data
1060220631_1060220638 11 Left 1060220631 9:121762385-121762407 CCTCTGACCCCCGCTTTAGTGTA No data
Right 1060220638 9:121762419-121762441 AGACCCTGGAGGTCGCCTGCTGG No data
1060220628_1060220638 27 Left 1060220628 9:121762369-121762391 CCCCGGGGGAGATGCACCTCTGA No data
Right 1060220638 9:121762419-121762441 AGACCCTGGAGGTCGCCTGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1060220638 Original CRISPR AGACCCTGGAGGTCGCCTGC TGG Intronic