ID: 1060220639

View in Genome Browser
Species Human (GRCh38)
Location 9:121762422-121762444
Sequence TGACCAGCAGGCGACCTCCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1060220639_1060220648 9 Left 1060220639 9:121762422-121762444 CCCTGGAGGTCGCCTGCTGGTCA No data
Right 1060220648 9:121762454-121762476 CCTCAGGCCACATGATCCCCAGG No data
1060220639_1060220646 -7 Left 1060220639 9:121762422-121762444 CCCTGGAGGTCGCCTGCTGGTCA No data
Right 1060220646 9:121762438-121762460 CTGGTCAGGAAGGGGTCCTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1060220639 Original CRISPR TGACCAGCAGGCGACCTCCA GGG (reversed) Intronic