ID: 1060220640

View in Genome Browser
Species Human (GRCh38)
Location 9:121762423-121762445
Sequence CTGACCAGCAGGCGACCTCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1060220640_1060220648 8 Left 1060220640 9:121762423-121762445 CCTGGAGGTCGCCTGCTGGTCAG No data
Right 1060220648 9:121762454-121762476 CCTCAGGCCACATGATCCCCAGG No data
1060220640_1060220646 -8 Left 1060220640 9:121762423-121762445 CCTGGAGGTCGCCTGCTGGTCAG No data
Right 1060220646 9:121762438-121762460 CTGGTCAGGAAGGGGTCCTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1060220640 Original CRISPR CTGACCAGCAGGCGACCTCC AGG (reversed) Intronic