ID: 1060220642

View in Genome Browser
Species Human (GRCh38)
Location 9:121762428-121762450
Sequence AGGTCGCCTGCTGGTCAGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1060220633_1060220642 12 Left 1060220633 9:121762393-121762415 CCCCGCTTTAGTGTATTCAGAGA No data
Right 1060220642 9:121762428-121762450 AGGTCGCCTGCTGGTCAGGAAGG No data
1060220635_1060220642 10 Left 1060220635 9:121762395-121762417 CCGCTTTAGTGTATTCAGAGAAT No data
Right 1060220642 9:121762428-121762450 AGGTCGCCTGCTGGTCAGGAAGG No data
1060220631_1060220642 20 Left 1060220631 9:121762385-121762407 CCTCTGACCCCCGCTTTAGTGTA No data
Right 1060220642 9:121762428-121762450 AGGTCGCCTGCTGGTCAGGAAGG No data
1060220634_1060220642 11 Left 1060220634 9:121762394-121762416 CCCGCTTTAGTGTATTCAGAGAA No data
Right 1060220642 9:121762428-121762450 AGGTCGCCTGCTGGTCAGGAAGG No data
1060220632_1060220642 13 Left 1060220632 9:121762392-121762414 CCCCCGCTTTAGTGTATTCAGAG No data
Right 1060220642 9:121762428-121762450 AGGTCGCCTGCTGGTCAGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1060220642 Original CRISPR AGGTCGCCTGCTGGTCAGGA AGG Intronic