ID: 1060220645 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 9:121762434-121762456 |
| Sequence | AGGACCCCTTCCTGACCAGC AGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | Yes |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | ||||
| Summary |
Found 1 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1060220645_1060220648 | -3 | Left | 1060220645 | 9:121762434-121762456 | CCTGCTGGTCAGGAAGGGGTCCT | No data | ||
| Right | 1060220648 | 9:121762454-121762476 | CCTCAGGCCACATGATCCCCAGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1060220645 | Original CRISPR | AGGACCCCTTCCTGACCAGC AGG (reversed) | Intronic | ||