ID: 1060220645

View in Genome Browser
Species Human (GRCh38)
Location 9:121762434-121762456
Sequence AGGACCCCTTCCTGACCAGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1060220645_1060220648 -3 Left 1060220645 9:121762434-121762456 CCTGCTGGTCAGGAAGGGGTCCT No data
Right 1060220648 9:121762454-121762476 CCTCAGGCCACATGATCCCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1060220645 Original CRISPR AGGACCCCTTCCTGACCAGC AGG (reversed) Intronic