ID: 1060222168

View in Genome Browser
Species Human (GRCh38)
Location 9:121770330-121770352
Sequence CTCCCGGACATTTCTAGGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 86
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 79}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1060222168_1060222174 10 Left 1060222168 9:121770330-121770352 CCTGCCCTAGAAATGTCCGGGAG 0: 1
1: 0
2: 0
3: 6
4: 79
Right 1060222174 9:121770363-121770385 ATGTAGATTTACCGATTCCTGGG 0: 1
1: 0
2: 1
3: 1
4: 70
1060222168_1060222173 9 Left 1060222168 9:121770330-121770352 CCTGCCCTAGAAATGTCCGGGAG 0: 1
1: 0
2: 0
3: 6
4: 79
Right 1060222173 9:121770362-121770384 AATGTAGATTTACCGATTCCTGG 0: 1
1: 0
2: 0
3: 8
4: 75

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1060222168 Original CRISPR CTCCCGGACATTTCTAGGGC AGG (reversed) Intronic
900942554 1:5810341-5810363 CGCCCGGGCGTTTCCAGGGCGGG - Intergenic
906842301 1:49152575-49152597 TTCCCATACATTTCTGGGGCTGG + Intronic
907014959 1:51003749-51003771 CTCCGGCACCTTTCTAGGACAGG - Intergenic
915141568 1:153771511-153771533 CTCCCTGACTGTTCTAGGGGAGG + Intronic
1063884194 10:10561321-10561343 CTCCAGGACATTTATTGGGCTGG + Intergenic
1067118706 10:43455905-43455927 CTCCCGGACTGTGCTAGAGCGGG - Intronic
1067709007 10:48633915-48633937 CTCCTGGAAATCTCTGGGGCAGG + Intronic
1067812384 10:49439818-49439840 GTCCCACACATCTCTAGGGCAGG + Intergenic
1072061718 10:91818824-91818846 CACCCGGACATTTTTAGGTTTGG + Intronic
1076779005 10:132713761-132713783 CTCCCGGATATCTCTGGAGCTGG + Intronic
1085817832 11:79759920-79759942 CTCCAGGACATTTCTGGAGAAGG - Intergenic
1086185028 11:84003068-84003090 CTTCCACAGATTTCTAGGGCAGG + Intronic
1093328335 12:17806454-17806476 CTTCAGGACCTTTTTAGGGCGGG - Intergenic
1093617052 12:21238418-21238440 GTCCCGGACATATCTAGGTCTGG + Intronic
1101845766 12:108361918-108361940 CACCCTGACATTTGTGGGGCCGG + Intergenic
1102522653 12:113488358-113488380 CTCCCTGACATTTCTCTGCCTGG + Intergenic
1107881016 13:44831926-44831948 CTCCAGGAGATTTAAAGGGCAGG + Intergenic
1108596799 13:51956338-51956360 CTCCAGGACACAGCTAGGGCAGG + Intronic
1109337098 13:61007538-61007560 CTTCCGCAGATCTCTAGGGCAGG - Intergenic
1110062744 13:71062952-71062974 GTCCCAGAGATCTCTAGGGCAGG + Intergenic
1110793713 13:79613174-79613196 GTTCCACACATTTCTAGGGCAGG + Intergenic
1112935669 13:104795027-104795049 CTCCCGGATCTTGCTAAGGCAGG + Intergenic
1115449120 14:33526123-33526145 CTCCCGGTAAGTTCTAAGGCTGG - Intronic
1119892241 14:78191649-78191671 CTTCCAGACATGTCTAGGGCTGG + Intergenic
1120209985 14:81624439-81624461 CTCCCTCACCATTCTAGGGCTGG - Intergenic
1125520721 15:40346531-40346553 CTCCAGGACATACCCAGGGCTGG + Intergenic
1126521992 15:49605717-49605739 CTCCAGGCCATTTCCAGGGGAGG - Intronic
1128090482 15:64915694-64915716 CTCCTGAACATTTCTGGAGCAGG - Intronic
1130418207 15:83714368-83714390 GTCCAGCACATTTCTAGGCCAGG + Intronic
1132209068 15:100007224-100007246 CTCCTGGACATTGTGAGGGCAGG - Intronic
1134069712 16:11253585-11253607 CTCCAGGACGTTTGTGGGGCTGG - Intronic
1135189374 16:20342438-20342460 CTCCAGGACACTGCTAGGCCAGG + Intronic
1140044964 16:71434369-71434391 CTCCAGGGCCTTCCTAGGGCTGG - Intergenic
1142147933 16:88500180-88500202 CTCCCAGACATCTCGGGGGCAGG + Intronic
1150128596 17:62654021-62654043 CTCAAGGACATTTCCAGGCCTGG + Intronic
1152383123 17:79952458-79952480 CTCCCTGACAGTTCTCAGGCTGG - Intronic
1156330257 18:36115080-36115102 CTGCAGTCCATTTCTAGGGCAGG + Intronic
1161672926 19:5624076-5624098 CTCCCGGGCAGTTCTGAGGCTGG - Intronic
1164524189 19:29001328-29001350 CACCCGGATATTTCCAGGGCTGG - Intergenic
1165119811 19:33551833-33551855 CTCCCGGGGCTTCCTAGGGCTGG + Intergenic
928303927 2:30149967-30149989 CTCCCTGGTATTTTTAGGGCTGG + Intronic
932076834 2:68672202-68672224 CTCCCAGATATTTGAAGGGCTGG - Intergenic
935052542 2:99536093-99536115 CTCCAGGACACATCTTGGGCAGG - Intergenic
935350123 2:102145368-102145390 CTCCCGGCCATGCCTAGTGCAGG + Intronic
937438299 2:121897029-121897051 CTCCCGGACCTTGCAAAGGCGGG + Intergenic
945437021 2:209830853-209830875 CTCCCAGAAATTTCTTGGGCAGG - Intronic
948721688 2:239904819-239904841 CTCCTGGAGACTTCTAGGGGAGG + Intronic
1169166753 20:3430688-3430710 CTCCCCGACATTTCTTGGTAAGG - Intergenic
1178552845 21:33556101-33556123 ATACTGGACATTTCTAGGCCAGG + Intronic
1184547507 22:45181535-45181557 CACCAGGACATTTCTAGAACTGG - Intronic
957630603 3:82711768-82711790 CTTCCGCATATCTCTAGGGCAGG + Intergenic
959610547 3:108289886-108289908 CTCAAAGACATTTCTAGGGTAGG - Intergenic
959619750 3:108387069-108387091 CTCCATGACAGTTCTATGGCTGG - Intronic
959746499 3:109781346-109781368 CACCCGGAAATTTACAGGGCAGG - Intergenic
965795391 3:172433628-172433650 GTCCCGCAGATCTCTAGGGCAGG + Intergenic
967505321 3:190246671-190246693 GTCCCAGAAATCTCTAGGGCAGG + Intergenic
970978961 4:22074801-22074823 ATTCCGCACATCTCTAGGGCAGG - Intergenic
978367502 4:107997613-107997635 CTCCATGACTTTTCTAGGCCTGG - Intronic
979679496 4:123444236-123444258 CTCCCTGATTTTTCTAGGTCTGG + Intergenic
980119074 4:128709209-128709231 CTACCATACACTTCTAGGGCTGG + Intergenic
983033972 4:162839306-162839328 CACAAGCACATTTCTAGGGCAGG - Intergenic
985180790 4:187259226-187259248 AGCCACGACATTTCTAGGGCAGG - Intergenic
985837074 5:2279462-2279484 CTCCTGGTCACTTCTGGGGCTGG - Intergenic
999589701 5:153131548-153131570 CTTCCAGAGATCTCTAGGGCAGG + Intergenic
1002386593 5:178871695-178871717 CTCCTGGACATCTCTGGGACTGG - Intronic
1005752371 6:28895511-28895533 CTCCAGGAAATATCTAGGGGAGG + Intergenic
1006115957 6:31776367-31776389 GTCCCGGACCTTTCTAAGGAGGG + Intronic
1006890846 6:37426855-37426877 CTCCTGGAGATTTAAAGGGCTGG - Intergenic
1012399433 6:98832269-98832291 CTCCCCCACCTTTCTGGGGCAGG - Intergenic
1016085208 6:139905103-139905125 GTTCCTGAAATTTCTAGGGCTGG - Intergenic
1019038542 6:169083384-169083406 CTGCCAGACTTTTCTAGGGAAGG - Intergenic
1022386668 7:29905781-29905803 CTCCTGGGGATTTCAAGGGCTGG + Intronic
1034810669 7:154129148-154129170 CTCTCTGACATTTCCAGGACGGG - Intronic
1040536272 8:48313692-48313714 CTCCCGGGCCTTTCTAGGCTAGG - Intergenic
1057870024 9:98709813-98709835 CCCCGGGAGACTTCTAGGGCGGG - Intergenic
1058222950 9:102325422-102325444 GTTCCGCAAATTTCTAGGGCAGG - Intergenic
1059652415 9:116327253-116327275 CTTCCTGACATCTCTAGGGCTGG + Intronic
1060222168 9:121770330-121770352 CTCCCGGACATTTCTAGGGCAGG - Intronic
1188553817 X:31389072-31389094 CTTGCAGACATTTCTTGGGCAGG - Intronic
1190598753 X:52069099-52069121 CTCCCGGTCCTGTCTGGGGCTGG + Intronic
1190610071 X:52184974-52184996 CTCCCGGTCCTGTCTGGGGCTGG - Intronic
1193076203 X:77358897-77358919 CTCCAAGACATATCTAGGCCTGG + Intergenic
1194364335 X:92995850-92995872 GTCCCACACATCTCTAGGGCAGG - Intergenic
1195720520 X:107863326-107863348 CTCCCTCACATCTATAGGGCAGG + Intronic
1197852511 X:130878211-130878233 CTCCAGAACATTTCTTTGGCTGG - Intronic
1200672567 Y:6112115-6112137 GTCCCACACATCTCTAGGGCAGG - Intergenic